DNA Research Advance Access published online on March 2, 2008
DNA Research, doi:10.1093/dnares/dsn004
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Exploration of Human ORFeome: High-Throughput Preparation of ORF Clones and Efficient Characterization of Their Protein Products
1 Department of Human Genome Research, Kazusa DNA Research Institute, 2-6-7 Kazusa-Kamatari, Kisarazu, Chiba 292-0818, Japan
2 Laboratory of Pharmacogenomics, Graduate School of Pharmaceutical Sciences, Chiba University, 1-8-1 Inohana, Chuo-ku, Chiba 260-8675, Japan
3 Graduate School of Science and Technology, Chiba University, 648 Matsudo, Matsudo, Chiba 271-8510, Japan
4 Graduate School of Science, Toho University, 2-2-1 Miyama, Funabashi, Chiba 274-8510, Japan
5 RIKEN Research Center for Allergy and Immunology, 1-7-22 Suehiro, Tsurumi-ku, Yokohama, Kanagawa 230-0045, Japan
Received 10 January 2008; accepted 29 January 2008.
| Abstract |
|---|
|
|
|---|
In this study, we established new systematic protocols for the preparation of cDNA clones, conventionally termed open reading frame (ORF) clones, suitable for characterization of their gene products by adopting a restriction-enzyme-assisted cloning method using the Flexi® cloning system. The system has following advantages: (1) preparation of ORF clones and their transfer into other vectors can be achieved efficiently and at lower cost; (2) the system provides a seamless connection to the versatile HaloTag® labeling system, in which a single fusion tag can be used for various proteomic analyses; and (3) the resultant ORF clones show higher expression levels both in vitro and in vivo. With this system, we prepared ORF clones encoding 1929 human genes and characterized the HaloTag-fusion proteins of its subset that are expressed in vitro or in mammalian cells. Results thus obtained have demonstrated that our Flexi® ORF clones are efficient for the production of HaloTag-fusion proteins that can provide a new versatile set for a variety of functional analyses of human genes.
Key words: cDNA; HaloTag; proteomics; Flexi cloning; ORFeome
| 1. Introduction |
|---|
|
|
|---|
The entire human genome sequence has allowed us to create a provisional catalog of human transcripts and proteins by a combination of computational predictions and information from experimentally collected cDNA sequences.1
-att recombination using the 25-bp attB site, and Cre-loxP recombination using the 34-bp lox-P site upstream of the ORF, respectively.7In this study, we prepared nearly 2000 ORF clones using the Flexi® cloning method, and the resultant ORF clones were examined with respect to production in cell-free protein synthesis systems as HaloTag-fusion proteins. The results indicated that the Flexi® cloning method was as efficient as the Gateway cloning method and that the Flexi ORF clones consistently produced equal or larger amounts of HaloTag-fusion proteins than Gateway clones in in vitro protein production systems. We also examined the subcellular localizations of 40 HaloTag-fusion proteins in HEK293 cells and confirmed that the results were equivalent to those of the corresponding Monster Green® Fluorescent Protein (MGFP)-fusion proteins. Taken together, these results indicate that the Flexi ORF clone set can perform efficient functional analyses of human genes and provide an alternative resource for the human ORFeome project.
| 2. Materials and methods |
|---|
|
|
|---|
2.1. Materials
pTD1 plasmid was obtained from Shimadzu (Kyoto, Japan). pF1Kof vector, which was constructed by flipping the AccIII–AgeI 832-bp DNA fragment including the origin of replication in the pF1KT7 (Promega, Madison, USA) vector, was kindly provided by Promega Corporation. pF3AHT vector was constructed by inserting the blunt-ended EcoICRI–SalI 946-bp DNA fragment from the pFC8A (HT) vector (Promega) into the EcoICRI site of the pF3A WG (BYDV) (Promega) vector backbone in the appropriate order for production of a C-terminal HaloTag-fusion protein. pFC8A (MGFP) was constructed by replacing the HaloTag gene with the MGFP gene from the phMGFP vector (Promega). For construction of HaloTag-fusion KIAA protein expression clones in the pTD2-Gateway and pTD2-Flexi vectors, KIAA ORFs with the HaloTag sequence were extracted from pF3AHT ORF clones. The ORFs for the synthetic firefly luciferase gene (luc2), HaloTag, and Venus were obtained from pGL4.10[luc2], pFC8A vector (Promega), and (EYFP-F46L/V68L/M153T/V163A/S175G)/pCS2 kindly provided by Dr. Atsushi Miyawaki (Brain Science Institute, RIKEN),13
2.2. Preparation of Flexi ORF clones
The ORF of interest was amplified from 1 to 4 ng of a plasmid DNA using 0.5 units of PrimeSTARTM HS DNA polymerase (Takara Bio, Shiga, Japan) in a 20-µL PCR reaction mixture that included 0.2 mM each of four dNTPs and 0.5 µM each of the gene-specific primers (5'-CCCCGCGATCGCCATG N17-3' and 5'-CCCCGTTTAAAC N20-3', where N17 indicates a 17 nt-sense sequence downstream from the start methionine codon of ORF and N20 indicates a 20 nt-anti-sense sequence upstream from the stop codon), under the following PCR conditions: 95°C for 2 min/30 cycles of 98°C for 10 s and 68°C for 3 min/68°C for 5 min. In some cases, 0.5 units of KOD-Plus-DNA Polymerase (Toyobo, Osaka, Japan) was used in a 25-µL PCR reaction mixture that included 0.2 mM each of four dNTPs, 1 mM MgCl2 and 0.3 mM each of the gene-specific primers under the following PCR conditions: 94°C for 2 min/30 cycles of 98°C for 10 s, 55°C for 30 s/68°C for 3 min. One-third of the resultant amplified PCR products was digested by SgfI and PmeI in a 10-µL reaction mixture of Flexi® buffer with 1x Flexi® Enzyme Blend (SgfI and PmeI) (Promega) for 30 min at 37°C after purification of the PCR products using Wizard SV 96 PCR Clean-Up System (Promega). After inactivation of the restriction enzymes by incubation for 20 min at 65°C, one-sixth of the digested PCR product was ligated with 25 ng of the SgfI- and PmeI-digested pF1K T7 vector in a 10-µL reaction of Flexi® Ligase buffer with 10 units of T4 DNA Ligase (Promega) for 60 min at 25°C. One microliter of the ligation reaction was used to transform 10 µL of JM109 Competent Cells (>108 cfu/µg, Promega), and the transformants were selected on LB agar plates containing 50 µg/mL of kanamycin. A randomly chosen clone was first examined using the CloneCheckerTM System (Invitrogen, Carlsbad, USA) by estimating the size of the supercoiled plasmid DNA. For ORFs cloned by the PCR cloning method, entire sequences were determined with the BigDye Terminator v3.1 Cycle Sequencing kit (Applied Biosystems, Foster City, USA), with sequencing primers designed every approximate 400 bp in a single strand of ORF. The sequence data were obtained with ABI PRISM 3700 or 3130, and analyzed with SEQUENCHERTM sequence assembly software (Gene Codes Co., Ann Arbor, USA). For ORF Trap cloning, the ORF of interest was transferred to pF1Kof vector using a homologous recombination system in E. coli (JC8679), according to the method previously described.9
For Flexi® Vector cloning using the pENT entry clones we had previously constructed,9
the ORF of interest was recovered by digestion with BstBI and SnaBI restriction endonucleases whose recognition sites were located upstream and downstream of the ORF, respectively, in the vector portion. It was then inserted between the BstBI and SnaBI sites of the pSP73Flexi-1 vector, which contains SgfI and PmeI sites upstream and downstream of the BstBI and SnaBI sites, respectively. After cloning the ORFs into the pSP73Flexi-1 vector, they were cut with SgfI and PmeI restriction endonucleases and then re-cloned between the SgfI and PmeI sites of the pF1K vector.
2.3. In vitro protein production
For in vitro translation systems using Wheat Germ Extract Plus (WGEP) (Promega) and a TransDirect insect cell lysate (TD) (Shimadzu, Japan), RNA synthesis was performed using the T7 RiboMAX Express Large Scale RNA Production System (Promega) with linearized template DNAs, according to the supplier's instructions. After purification with the RNeasy Mini Kit (QIAGEN, Hilden, Germany), RNAs were concentrated by ethanol precipitation and dissolved in 15 µL of DEPC-treated water. In vitro translation reactions were performed in a reaction volume of 10 µL using 2.4 and 3.2 µg of the RNA for the WGEP and the TD systems, respectively, following the supplier's recommendation unless otherwise stated. For the TNT SP6 High-Yield Protein Expression (HYPE) System (Promega), approximately 400 ng of TempliPhi-amplified pF3AHT HaloTag-fusion protein expression clones were used as a template in a 10-µL reaction, according to the manufacturer's instructions. For production of radiolabeled proteins, 2.86 µCi of 35S-labeled Redivue Promix (a mixture of L-[35S]methionine and L-[35S] cysteine) (GE Healthcare, USA) was added in the reaction. The TempliPhi (GE Healthcare) reaction was conducted by denaturation of 10–30 ng of DNAs with 5 µL of Denature buffer for 3 min at 95ºC followed by polymerization for 16 h at 30ºC. For the HaloTag tetramethylrhodamine (TMR) ligand labeling of the in vitro produced HaloTag-harboring proteins, 2.3 µL of 1 µM HaloTag-TMR ligand (Promega) was added after the in vitro reaction (10 µL) and the mixture was incubated for 5–10 min at room temperature. After the addition of 4.2 µL of 4x Laemmli's SDS sample buffer, the products were resolved on a MDG-267 Real Gel Plate (concentration gradient: 5–10%; Biocraft, Japan) by polyacrylamide gel electrophoresis in the presence of SDS (SDS–PAGE).
2.4. Examination of the effects of the flanking sequences of ORF on in vitro production of luciferase, Venus, and HaloTag
For in vitro luc2 production, 1.4 µg of RNAs were used for WGEP and 3.8 µg for TD in a reaction volume of 12 µL. The activities of luc2 in an aliquot of the reaction mixture (10 µL) were assayed using the Dual-Glo Luciferase Assay System (Promega) according to the supplier's instructions. Luminescence was detected in a GloMAX 96 Microplate Luminometer (Promega). In vitro syntheses of Venus proteins were performed in 20 µL using 4.8 and 6.4 µg of the template RNA in the WGEP and the TD systems, respectively, after removing turbidity by centrifugation at 15 000 rpm for 2 min. Fluorescent signals were detected in the Applied Biosystems 7500 Fast Real-Time PCR System after 2 and 5 h reactions in the WGEP and TD systems, respectively. HaloTag-TMR ligand binding was monitored for quantification of the active HaloTag protein. Two microliters of 5 µM HaloTag-TMR ligand was added to an 8-µL reaction mixture, and the mixture was incubated at 25°C for 5 min. The binding reaction was stopped by adding 2 µL of 6x Laemmli's SDS sample buffer and then boiling at 100°C for 5 min. The solution (7.5 µL) was analyzed on 12.5% SDS–PAGE. Fluorescent signals from TMR were detected and quantified with FLA-3000 (Fujifilm, Tokyo, Japan) and MultiGauge image analyzing software (Fujifilm).
2.5. Western blotting
For Western blot analysis of HaloTag-fusion proteins, the proteins separated by SDS–PAGE were electrophoretically transferred onto a PVDF membrane (FluoroTrans W; PALL, Portsmouth, UK) using the transfer buffer [25 mM Tris–Cl (pH 8.3), 192 mM glycine, 20% (V/V) methanol] with the BIOCRAFT BE-300 semidry transfer device (Biocraft, Tokyo, Japan). HaloTag-fusion proteins were detected as follows. The resultant PVDF membrane was washed with TBS [20 mM Tris–Cl (pH 7.5) and 150 mM NaCl] including 0.05% Tween-20 (TBST) for 10 min with gentle agitation. After pre-incubation of the membrane with TBST containing 5% skim milk for 60 min, the membrane was incubated with 1:30 000 rabbit anti-HaloTag IgG antibody (Promega) in TBST containing 1% skim milk for 60 min. After washing with TBST for 5 min four times, the membrane was further incubated with 1:30 000 horseradish-peroxidase-conjugated anti-rabbit IgG antibody (Promega) in TBST containing 1% skim milk for 60 min. After washing the membrane with TBST, HaloTag-fusion proteins were finally detected using ECL plus (GE Healthcare) according to the manufacturer's instructions. The luminescent images were recorded by a Luminescent Image Analyzer LAS3000 (Fujifilm). MagicMark XP Western Protein Standard (Invitrogen) was used for estimation of the apparent molecular masses of the HaloTag-fusion proteins.
2.6. Examination of the subcellular localization of HaloTag-fusion proteins
The human embryonic kidney (HEK) 293 cell line was obtained from HSRRB of the Japan Health Sciences Foundation. HEK293 and COS-7 cell lines were grown in DMEM supplemented with 10% of Tet System Approved Fetal Bovine Serum (BD) and 1x Antibiotic–Antimycotic reagent (100 U/mL penicillin + 100 µg/mL streptomycin + 0.25 µg/mL amphotericin B; Invitrogen). HEK293 and COS-7 were transfected with expression clones using FuGENE6 Transfection Reagent (Roche Diagnostics, Basel, Switzerland) in an 8-well chambered coverglass (Thermo Fisher Scientific, Rochester, USA) according to the supplier's instructions. Cells (200 µL, 4 x 104) were plated 24 h before transfection. After 16–24 h of transfection, HaloTag-fusion proteins and DNA were labeled with medium with 1 µM of HaloTag-TMR ligand and Hoechst (33342, 3.3 µg/mL, final concentration; Sigma-Aldrich, St. Louis, USA) for 15 min in a CO2 (5%) incubator at 37ºC. After washing four times with 300 µL of medium, the cells were incubated for 0.5–24 h in a CO2 incubator and the subcellular localization of HaloTag- or MGFP-fusion proteins were observed with a Biozero fluorescence microscopy system (Keyence, Osaka, Japan) with 605/55 and 535/50 nm filters. Photos labeled with Hoechst33342 were merged with those of MGFP- or HaloTag-fusion proteins and the subcellular localizations of MGFP- and HaloTag-fusion proteins were compared.
| 3. Results and discussion |
|---|
|
|
|---|
3.1. Construction of Flexi ORF clones
Led by the motivation described in Section 1, we have initiated preparation of Flexi® Vector ORF clones using human cDNA clones accumulated by the Kazusa cDNA project.14
|
Information about the Flexi ORF clones (i.e. ORF nucleotide sequences, the predicted primary sequences of the gene products, corresponding Ensembl gene ID, and gene description2
3.2. Comparison of the productivities of HaloTag-fusion proteins from Flexi ORF clones and Gateway ORF clones in two in vitro protein production systems
Since our focus is on the use of HaloTag® technology, we initially prepared a set of Flexi ORF clones as HaloTag-fusions using the Flexi® cloning method. To examine the utility of HaloTag® technology, HaloTag-fusion products were produced in in vitro translation systems. The expressed proteins were analyzed on SDS–PAGE after labeling with a HaloTag-TMR ligand. This simple labeling procedure enabled us to fluorometrically detect only proteins carrying a HaloTag portion on SDS–PAGE, and thereby made it easy to check whether the ORF encoded an appropriately sized protein. Using this analysis, quantities of HaloTag-fusion proteins with ligand-binding activity could be directly estimated from the fluorescence intensities of protein bands on SDS–PAGE. In these experiments, we also compared the performance of two in vitro translation systems: one derived from a wheat germ extract and the second from an insect cell extract [commercially named WGEP and TransDirect (TD), respectively]. We used these systems because these eukaryotic cell extracts are known to produce larger amounts of proteins than conventional rabbit reticulocyte lysates. In parallel, we also compared the efficiency of protein synthesis by Gateway-type (pTD2-Gw) and Flexi-type (pTD2-Flx) expression constructs, where ORFs were flanked with different appended sequences that are associated with the respective cloning methods. These appended sequences may affect the translational activity of the HaloTag-fusion constructs in vitro. For this purpose, we constructed 13 sets of HaloTag-fusion protein expression plasmids using pTD2-Gw and pTD2-Flx vectors. pTD2-Flx is a simple Flexi-type HaloTag-fusion protein expression vector derived from the pTD1 vector for the TD system.19
This vector has 8-bp restriction enzyme recognition sites (SgfI and PmeI sites) flanked by the baculovirus polyhedrin 5'- and 3'-UTRs, respectively. pTD2-Gw is a hybrid expression vector derived from pTD2-Flx, which has 25-bp Gateway recombination sites, attB1 or attB2, between polyhedrin 5'-UTR and SgfI, or between PmeI and 3'-UTR, respectively (Fig. 2A). In both systems, protein production was directed by in-vitro-synthesized RNAs. Many fluorescent bands, probably resulting from proteolytic degradation, were observed in most samples. The fluorescence signal intensities of the largest bands were the expected size for the respective protein products, and each HaloTag-fusion protein was recorded for comparing the protein productivities of pTD2-Flx and pTD2-Gw (Fig. 2B, indicated by an arrow). In the TD system, the fluorescence intensities of 8 out of 13 HaloTag-fusion proteins in the pTD2-Gw format were less than 60% as intense as those derived from pTD2-Flx clones (Fig. 2B, upper lanes: 2, 3, 5, 8–11, and 13). On the other hand, in the WGEP expression system, the fluorescence intensities of HaloTag-fusion proteins from five fusion constructs in the pTD2-Gw vector were slightly reduced compared with those from pTD2-Flx fusion constructs (Fig. 2B, lower lanes: 3, 4, 8–10). Interestingly enough, the fluorescent band patterns of HaloTag-fusions produced in the TD and WGEP systems were considerably different from each other, although the same in-vitro-synthesized RNAs were subjected to both in vitro protein production systems. These results indicated that (1
) the protein productivity of both the TD and WGEP systems varied widely from gene to gene, (2
) TD and WGEP had different preferences for genes in terms of protein production, and (3
) the Gateway recombination site(s) apparently had an inhibitory effect on translational activity, which was more prominent in the TD systems.
|
3.3. Effects of ORF-flanking sequences on translational activity in cell-free protein synthesis systems
While the different performances of the TD and WGEP systems were anticipated to some extent, it was not anticipated that the Gateway recombination sites would have an inhibitory effect on in vitro protein production. Thus, we further pursued the cause of this apparent inhibitory effect of the Gateway recombination sites on in vitro protein production. To systematically examine the effects of the appended sequences flanking the ORFs on in vitro protein production, we constructed systematically modified versions of expression clones for luc2, HaloTag, and Venus autofluorescent proteins, with different flanking sequences for each ORF (Fig. 2C). Protein production in the TD and WGEP systems was monitored by measuring luciferase activity, HaloTag-TMR ligand-binding activity, or the fluorescence intensity of Venus protein (Fig. 2D). As shown in Fig. 2C, these clones included flanking sequences derived from the Gateway attB sites (B1 and/or B2), or parts of the kanamycin-resistant gene (K1: ACTGGGCACAACAGACAATCGGCTG, or K2: CCTGTCATCTCACCTTGCTCCTGCC, as examples of non-specific sequences) between the translational enhancer (polyhedrin 5'-UTR) and the initiation ATG codon, and/or between the stop codon and the polyhedrin 3'-UTR. N–N, an expression clone without any additional sequences, was the control clone. N–B2 and N–K2 carry additional sequences (B2 and K2, respectively) only at the 3'-flanking site, whereas B1–N and K1–N have additional sequences (B1 and K1, respectively) only at the 5'-flanking site. K1 and K2 were spacer sequences with equal sizes as B1 and B2 and were not expected to be involved with the Gateway recombination. We also compared protein production from the Gateway-type expression vector (B1–B2) and the modified vector (B1–K2) in parallel. In total, we examined seven different expression vectors in these experiments. Figure 2D shows the relative activities of luc2, HaloTag, and Venus proteins produced in the TD and WGEP systems compared with the N–N type of pTDFlexi vector. Under these experimental conditions, the luciferase expression clones with attB1 sequence upstream of the ORFs (Fig. 2, B1–N, B1–B2, and B1–K2) appeared to exhibit only a slight inhibitory effect in the TD and WGEP systems in comparison with the pTDFlexi-luc2 construct (N–N in Fig. 2C). This reduction in protein productivity seemed to depend on the distance (39 nucleotides) between the 5' translational enhancer and the initiation ATG but not the specific nucleotide sequence, at least in insect TD systems. Expression clones with short nucleotide sequences of the same length derived from the kanamycin-resistant gene also reduced the production of luciferase (Fig. 2D, upper, K1–N). Such an inhibitory effect was more evident for HaloTag and Venus protein production in the TD system. In fact, in the TD system, both HaloTag-TMR-ligand-binding activity and the fluorescence intensity of Venus decreased to less than 50% when the additional sequences were located upstream of the ORF (Fig. 2D, upper, B1–N, K1–N, B1–B2, and B1–K2). These results indicated that protein productivity in the TD system was affected by the increase in distance between the polyhedrin 5'-UTR and the start ATG, rather than by the flanking nucleotide sequence of the spacer.
It was reported that the polyhedrin 5'-UTR in pTD1 displayed a strong translational enhancing activity, even in the wheat germ extract and rabbit reticulocyte lysate systems.19
The inhibitory effect of sequences upstream of the ORF was prominent in the TD system but only minor in the WGEP system (Fig. 2D, lower). Our results also showed that the expression clone lacking 5'-UTR considerably reduced the productivity of luciferase in both the TD and WGEP systems, indicating that the translational enhancer of 5'-UTR in pTD1 was functional in each system (Fig. 2D, D5). On the other hand, translational activity was largely unaffected by the spacing between the 3'-translational enhancer and the translational stop codon in all experiments using luc2, HaloTag, and Venus proteins (Fig. 2D, N–B2, N–K2). Taking all these results together, we concluded that the spacing between the 5'-translational enhancer and the translational initiation codon affected protein productivity, at least in vitro. Although the mechanism of the inhibitory effect on translational activity by spacing remains to be elucidated, it appears that nucleotide spacing between the enhancer and the initiation codon can sometimes affect translational activity. Because the distance between the 5'-translational enhancer and the initiation codon is shorter in the Flexi ORF clone than in the Gateway ORF clone, these results suggest that the Flexi ORF clone could be the clone of choice to consistently obtain high protein productivity in both the TD and WGEP systems. We consider this as another benefit of using the Flexi ORF clones, since production level is a serious concern, particularly when a recombinant protein is synthesized in vitro.
3.4. Quality check of ORF clones from the viewpoint of in vitro protein production
Based on the results described above, we confirmed the functionality of a number of Flexi ORF clones produced as HaloTag-fusions in in vitro protein production systems. For this purpose, we used a transcription/translation coupled wheat-germ-cell-free protein synthesis system [TNT SP6 High Yield Protein Expression System, hereafter abbreviated as (TNT SP6 HYPES)] because the coupled system is easier and faster to operate and gives a higher yield of recombinant protein production than other uncoupled cell-free protein synthesis systems. Eight hundred and fourteen ORF sequences in pF1K clones were transferred to pF3AHT, C-terminal HaloTag-fusion protein expression vectors, by Flexi® cloning methods. One practical problem we encountered was that the coupled system required a large amount of expression plasmids to obtain the best results. Since we planned to use a small volume of E. coli culture (about 1 mL) to produce the plasmids, we were concerned that we would not be able to produce enough DNA to obtain good results in the TNT system. To solve this problem, we took advantage of in vitro amplification of expression plasmids. We found that DNA amplified with a TempliPhi rolling circle amplification kit could be used as template DNA in the TNT SP6 HYPES without any purification.20
This enabled us to examine the production of a number of HaloTag-fusions in a high-throughput manner. As a result, medium-sized and even relatively large proteins, composed of more than 1000 amino acid residues, were effectively produced and detected by Western blot analysis using anti-HaloTag IgG, with only small amounts of degraded or inappropriately initiated proteins (Fig. 3A). Moreover, most of the HaloTag-fusion proteins retained HaloTag ligand-binding activities (Fig. 3B). Of the 814 pF3AHT clones tested in the TNT system, 97% produced recombinant proteins that could be detected by TMR HaloTag ligand labeling and Western blot analysis using anti-HaloTag antibody. The apparent molecular masses of the recombinant proteins were estimated by SDS–PAGE followed by Western blot analysis using anti-HaloTag antibodies. Most of the proteins had apparent molecular masses that were consistent with the numbers of amino acid residues of the fused proteins (data not shown). Although the fluorescence intensity of TMR varied widely from protein to protein in a range of arbitrary fluorescence units from 10 to 10 000, HaloTag-fusions that retained the functional characteristics of TMR ligand-binding were efficiently produced. However, we did observe a tendency of HaloTag-TMR ligand binding to display decreases in fluorescence intensity with increases in protein size (Fig. 3C). These results are most likely explained by decreases in the production levels of larger HaloTag-fusions. However, it could also be explained on the assumption that the partner proteins may affect HaloTag-TMR ligand-binding activities. To address this, we examined the relationship between protein yields and their HaloTag ligand-binding activities for 53 HaloTag-fusions. In this experiment, the HaloTag-fusion protein yields were expressed by the radioactivity of [35S]methionine and [35S]cysteine incorporated into the proteins and divided by the number that contained methionine and cysteine, while the HaloTag ligand-binding activities were estimated from the fluorescence intensity of Cy5-labeled HaloTag ligand-bound HaloTag-fusion proteins on SDS–PAGE. The HaloTag-fusion protein yields and the HaloTag ligand-binding activities are plotted against the number of their amino acid residues in Fig. 3D and E, respectively. In Fig. 3F, the ratios of the HaloTag ligand-binding activities to the yields of the HaloTag-fusion proteins are plotted against the number of amino acid residues. The results indicated that the molecular HaloTag ligand-binding activities did not vary widely from fusion to fusion. Based on this result, we consider that the low ligand-binding activities observed resulted from low production levels of HaloTag-fusion proteins, although there may have been some exceptions.
|
3.5. Subcellular localization of HaloTag-fusion proteins and MGFP-fusion proteins
In general, information on the subcellular localization of proteins provides us with an important clue on potential protein function. Thus, we accumulated data of the subcellular localizations using green fluorescent protein (GFP)–ORF fusions constructed using the Gateway system. It was important for us to confirm that the subcellular localization revealed by HaloTag-fusions was consistent with the subcellular localization observed for GFP-fusions. First, we examined whether or not the HaloTag protein could be located in an expected subcellular compartment upon fusion of localization signals in COS-7 cells. To do this, we prepared pFC8A expression clones for the HaloTag protein containing signal sequences, such as membane-localized signal (Memb),21
|
In conclusion, a complete set of ORF resources in various expression-ready clone formats clearly can serve as versatile sets of reagents for functional genomics research. The rapid, easy, and assured transfer of ORF sequences into different expression vectors is highly critical for this purpose, since many ORF clones are used in combination with protein fusion tags that allow functional analysis. Within this context, we selected a HaloTag protein as a fusion partner because we considered that HaloTag® technology would provide a wide range of utilities that include detection and purification as well as adaptability in functional studies. In fact, we have successfully used HaloTag-fusion proteins in other studies for pulse-chase labeling, protein–protein interaction, and chromosomal immunoprecipitation-like analyses along with bioimaging (unpublished data). In this report, we have shown that the Flexi® cloning method is suitable for the preparation of a large number of ORF clones into the pF1K vector and allows seamless implementation of HaloTag® interchangeable technology. Moreover, we have demonstrated that most human proteins were efficiently expressed as HaloTag-fusions in an in vitro coupled protein expression system, as well as in cultured mammalian cells. The resultant HaloTag-fusion proteins were biochemically active and successfully used for analyses of subcellular localization as an alternative to conventional autofluorescent proteins. Based on these results, we will accumulate a number of human ORF clones in the form of expression plasmids for HaloTag-fusion proteins, either C- or N-terminal fusions, in our ORFeome project since they will be directly used for functional studies, as well as for further transfer to another vector. HaloTag® technology provides a single fusion tag that can be utilized for a variety of structural and functional proteomic studies. Although there are a number of ORFeome resources for human genes that have been generated by Gateway recombinational cloning,27
| Funding |
|---|
|
|
|---|
This project was supported in part by a grant for Promega-Kazusa scientific collaboration from Promega Corporation and by a special grant for acceleration of the practical application of biotechnology from Chiba Prefectural Government.
| Supplementary material |
|---|
|
|
|---|
Supplementary data are available online at www.dnaresearch.oxfordjournals.org.
| Acknowledgements |
|---|
|
|
|---|
We would like to thank J. Hartnett and M. Slater for their gift of the pF1Kof vector and A. Miyawaki for providing us with venus/pCS2 plasmid. We are grateful to B. Bulleit for his valuable comments. We also thank K. Ozawa, K. Sumi, T. Watanabe, K. Yamada, S. Yokoyama, M. Takazawa, N. Kashima, M. Tamura, H. Kinoshita, E. Suzuki, and C. Mori for their technical assistance.
| Footnotes |
|---|
* To whom correspondence should be addressed. Tel. +81 438-52-3930. Fax. +81 438-52-3931. E-mail: nagase{at}kazusa.or.jp
| References |
|---|
|
|
|---|
- Brent M. R. Genome annotation past, present, and future: how to define an ORF at each locus. Genome Res. (2006) 15:1777–1786.[CrossRef][Web of Science]
- Hubbard T. J. P., Aken B. L., Beal K., et al. Ensembl 2007. Nucleic Acids Res. (2007) 35:D610–D617.
[Abstract/Free Full Text] - Rual J. F., Hill D. E., Vidal M. ORFeome projects: gateway between genomics and omics. Curr. Opin. Chem. Biol. (2004) 8:20–25.[CrossRef][Web of Science][Medline]
- Brizuela L., Richardson A., Marsischky G., Labaer J. The FLEXGene repository: exploiting the fruits of the genome projects by creating a needed resource to face the challenges of the post-genomic era. Arch. Med. Res. (2002) 33:318–324.[CrossRef][Web of Science][Medline]
- Temple G., Lamesch P., Milstein S., et al. From genome to proteome: developing expression clone resources for the human genome. Hum. Mol. Genet. (2006) 15:R31–R43.
[Abstract/Free Full Text] - Walhout A. J., Temple G. F., Brasch M. A., et al. GATEWAY recombinational cloning: application to the cloning of large numbers of open reading frames or ORFeomes. Methods Enzymol. (2000) 328:575–592.[Web of Science][Medline]
- Marsischky G., LaBaer J. Many paths to many clones: a comparative look at high-throughput cloning methods. Genome Res. (2004) 14:2020–2028.
[Abstract/Free Full Text] - Blommel P. G., Martin P. A., Wrobel R. L., Steffen E., Fox B. G. High efficiency single step production of expression plasmids from cDNA clones using the Flexi Vector cloning system. Protein Expr. Purif. (2006) 47:562–570.[CrossRef][Web of Science][Medline]
- Nakajima D., Saito K., Yamakawa H., et al. Preparation of a set of expression-ready clones of mammalian long cDNAs encoding large proteins by the ORF trap cloning method. DNA Res. (2005) 12:257–267.
[Abstract/Free Full Text] - Los V. G., Wood K. Methods in Molecular Biology. Taylor D. L., Haskins J. R., Giuliano K., eds. (2007) 356. Totowa: Human Press. 195–208.
- Keppler A., Gendreizig S., Gronemeyer T., Pick H., Vogel H., Johnsson K. A general method for the covalent labeling of fusion proteins with small molecules in vivo. Nat. Biotechnol. (2003) 21:86–89.[CrossRef][Web of Science][Medline]
- Gronemeyer T., Godin G., Johnsson K. Adding value to fusion proteins through covalent labeling. Curr. Opin. Biotechnol. (2005) 16:453–458.[CrossRef][Web of Science][Medline]
- Nagai T., Ibata T., Park E. S., Kubota M., Mikoshiba K., Miyawaki A. A variant of yellow fluorescent protein with fast and efficient maturation for cell-biological applications. Nat. Biotechnol. (2002) 20:87–90.[CrossRef][Web of Science][Medline]
- Ohara O., Nagase T., Ishikawa K.-I., et al. Construction and characterization of human brain cDNA libraries suitable for analysis of cDNA clones encoding relatively large proteins. DNA Res. (1997) 4:53–59.[Abstract]
- Nagase T., Koga H., Ohara O. Kazusa mammalian cDNA resources: towards functional characterization of KIAA gene products. Brief. Funct. Genomic Proteomic. (2006) 5:4–7.
[Abstract/Free Full Text] - Gillen J. R., Willis D. K., Clark A. J. Genetic analysis of the RecE pathway of genetic recombination in Escherichia coli K-12. J. Bacteriol. (1981) 145:521–532.
[Abstract/Free Full Text] - Oliner J. D., Kinzler K. W., Vogelstein B. In vivo cloning of PCR products in E. coli. Nucleic Acids Res. (1993) 21:5192–5197.
[Abstract/Free Full Text] - Zhang Y., Buchholz F., Muyrers J. P., Stewart A. F. A new logic for DNA engineering using recombination in Escherichia coli. Nature Genet. (1998) 20:123–128.[CrossRef][Web of Science][Medline]
- Suzuki T., Ito M., Ezure T., et al. Performance of expression vector, pTD1, in insect cell-free translation system. J. Biosci. Bioengineer. (2006) 102:69–71.[CrossRef]
- Dean F. B., Nelson J. R., Giesler T. L., Lasken R. S. Rapid amplification of plasmid and phage DNA using Phi29 DNA polymerase and multiply-primed rolling circle amplification. Genome Res. (2001) 11:1095–1099.
[Abstract/Free Full Text] - Skene J. H., Virag I. Posttranslational membrane attachment and dynamic fatty acylation of a neuronal growth cone protein, GAP-43. J. Cell Biol. (1989) 108:613–624.
[Abstract/Free Full Text] - Lanford R. E., Kanda P., Kennedy R. C. Induction of nuclear transport with a synthetic peptide homologous to the SV40 T antigen transport signal. Cell (1986) 46:575–582.[CrossRef][Web of Science][Medline]
- Fliegel L., Burns K., MacLennan D. H., Reithmeier R. A., Michalak M. Molecular cloning of the high affinity calcium-binding protein (calreticulin) of skeletal muscle sarcoplasmic reticulum. J. Biol. Chem. (1989) 264:21522–21528.
[Abstract/Free Full Text] - Llopis J., McCaffery J. M., Miyawaki A., Farquhar M. G., Tsien R. Y. Measurement of cytosolic, mitochondrial, and Golgi pH in single living cells with green fluorescent proteins. Proc. Natl. Acad. Sci. USA (1998) 95:6803–6808.
[Abstract/Free Full Text] - Rizzuto R., Brini M., Pizzo P., Murgia M., Pozzan T. Chimeric green fluorescent protein as a tool for visualizing subcellular organelles in living cells. Curr. Biol (1995) 5:635–642.[CrossRef][Web of Science][Medline]
- The UniProt Consortium. The universal protein resource (UniProt). Nucleic Acids Res. (2007) 35:D193–D197.
[Abstract/Free Full Text] - Lamesch P., Li N., Milstein S., et al. hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes. Genomics (2007) 89:307–315.[CrossRef][Web of Science][Medline]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



