Skip Navigation


DNA Research Advance Access originally published online on May 4, 2009
DNA Research 2009 16(3):165-176; doi:10.1093/dnares/dsp008
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Data
Right arrowOA All Versions of this Article:
16/3/165    most recent
dsp008v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Request Permissions
Google Scholar
Right arrow Articles by Diekmann, K.
Right arrow Articles by Barth, S.
PubMed
Right arrow PubMed Citation
Right arrow Articles by Diekmann, K.
Right arrow Articles by Barth, S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2009. Kazusa DNA Research Institute
The online version of this article has been published under an open access model. Users are entitled to use, reproduce, disseminate, or display the open access version of this article for non-commercial purposes provided that: the original authorship is properly and fully attributed; the Journal and Oxford University Press are attributed as the original place of publication with the correct citation details given; if an article is subsequently reproduced or disseminated not in its entirety but only in part or as a derivative work this must be clearly indicated. For commercial re-use, please contact journals.permissions@oxfordjournals.org

Complete Chloroplast Genome Sequence of a Major Allogamous Forage Species, Perennial Ryegrass (Lolium perenne L.)

Kerstin Diekmann1,2,*, Trevor R. Hodkinson2, Kenneth H. Wolfe3, Rob van den Bekerom1,4, Philip J. Dix4 and Susanne Barth1

1 Teagasc Crops Research Centre, Oak Park, Carlow, Ireland
2 School of Natural Sciences, Trinity College Dublin, Dublin 2, Ireland
3 Smurfit Institute of Genetics, Trinity College Dublin, Dublin 2, Ireland
4 Department of Biology, National University of Ireland Maynooth, Maynooth, Ireland

Received 10 February 2009; accepted 12 April 2009.


    Abstract
 Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results and discussion
 Supplementary data
 Funding
 Acknowledgements
 References
 
Lolium perenne L. (perennial ryegrass) is globally one of the most important forage and grassland crops. We sequenced the chloroplast (cp) genome of Lolium perenne cultivar Cashel. The L. perenne cp genome is 135 282 bp with a typical quadripartite structure. It contains genes for 76 unique proteins, 30 tRNAs and four rRNAs. As in other grasses, the genes accD, ycf1 and ycf2 are absent. The genome is of average size within its subfamily Pooideae and of medium size within the Poaceae. Genome size differences are mainly due to length variations in non-coding regions. However, considerable length differences of 1–27 codons in comparison of L. perenne to other Poaceae and 1–68 codons among all Poaceae were also detected. Within the cp genome of this outcrossing cultivar, 10 insertion/deletion polymorphisms and 40 single nucleotide polymorphisms were detected. Two of the polymorphisms involve tiny inversions within hairpin structures. By comparing the genome sequence with RT–PCR products of transcripts for 33 genes, 31 mRNA editing sites were identified, five of them unique to Lolium. The cp genome sequence of L. perenne is available under Accession number AM777385 [GenBank] at the European Molecular Biology Laboratory, National Center for Biotechnology Information and DNA DataBank of Japan.

Key words: chloroplast genome; Lolium perenne; Poaceae; chloroplast DNA variation; RNA editing


    1. Introduction
 Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results and discussion
 Supplementary data
 Funding
 Acknowledgements
 References
 
Chloroplasts (cps), plant cell organelles derived from independent living cyanobacteria,1Go–3Go contain their own small genome averaging 150 kb in flowering plants. The cp genome molecules can be circular or linear, mono- or multimeric,4Go but the genome can be represented by a monomeric circular map containing two copies of an inverted repeat (IR) region (~23 kb) which separate a small single copy (SSC) region (~18 kb) from a large single copy (LSC) region (~84 kb). In most angiosperm species, the cp genome contains ~113 different genes5Go that primarily encode for proteins and RNAs for the photosynthetic system and that are generally highly conserved in terms of content and order among plant families.6Go Cp genomes are usually inherited maternally,7Go and this property is useful for several applications such as for defining cytoplasmic breeding pools in plant breeding, and tracking parentage in interspecific hybrids (e.g. Arabidopsis suecica8Go). Cp genetic engineering is also an ideal approach for minimizing the risk of spreading transgenes into wild plants via pollen.9Go In comparison with nuclear genetic engineering, much higher expression of the transgenic insertion can also be obtained because of the high copy number of cp genomes within a single plant cell. Cp genome sequences are also highly suitable for phylogenetic studies.10Go

To date (February 2009), entire cp genome sequences of 117 streptophytic species are publicly available (http://www.ncbi.nlm.nih.gov/genomes/ORGANELLES /plastids_tax.html). Only 18 of these genome sequences belong to the monocot group of angiosperms, and of these 13 are from the grass family Poaceae. Poaceae include the most important agricultural plant species from a socio-economic perspective as they contain the cereals and forage species.11Go Lolium perenne (perennial ryegrass) is globally one of the most important grassland species especially for the northern hemisphere (http://www.worldseed.org). In 2006–2007, more than one-third of world grass seed production was from L. perenne. Thus L. perenne has the highest economic impact as a forage and grassland crop. It is a cross-pollinating species and cultivar populations consist of a heterozygous nuclear genome background.

Several methods exist for obtaining complete cpDNA sequences. The Arabidopsis thaliana cp genome, for example, was sequenced using cpDNA clones found as ‘contaminations’ in genomic libraries.12Go The cp genome of Nicotiana sylvestris, the maternal genome donor of Nicotiana tabacum, was obtained by sequencing extracted high-purity cpDNA that was cloned into sequencing vectors.13Go A commonly used method involves amplifying the cp genome by rolling circle amplification and then cloning this product into sequencing vectors.14Go Recently, consensus cpDNA sequencing primers have become available for sequencing cp genomes using a primer walking strategy.15Go For sequencing the cp genome of L. perenne, we extracted high-purity cpDNA which we amplified with a whole genome amplification kit and used a shotgun sequencing approach. Thus each region of the genome was sequenced several fold from independent clones, which allowed us to detect SNPs and indels.

Few studies have examined variation of the cp genome within a population of a species. However, McGrath et al.16Go discovered more than 500 haplotypes within 1575 individual plants of Lolium, Festulolium and Festuca populations. We hope to add to this information by assessing cp genome variation within a Lolium cultivar by detecting SNPs and indels. This assessment should reveal highly variable regions in the Lolium cp genome, from which markers can be designed for assessing cytoplasmic breeding pools and to add to population genetic and phylogenetic studies.

In this study, we also analysed RNA editing sites in L. perenne cp transcripts. RNA editing is a repair mechanism that alters the genetic information of land plant organelles at the transcript level. It is a post-transcriptional modification (mostly C to U conversion) of the nucleotide sequence of pre-mRNAs by inserting, deleting or substituting nucleotides in order to yield functional RNA species.17Go,18Go Editing in cps was first discovered by Hoch et al.19Go for the cp rpl2 gene in maize, where it creates a start codon and hence restores the functionality of the rpl2 gene. Knowledge about RNA editing sites is essential for describing the functional capability of cp genes, characterizing different species and obtaining a better understanding of how these sites have evolved.


    2. Materials and methods
 Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results and discussion
 Supplementary data
 Funding
 Acknowledgements
 References
 
2.1. Sequencing, assembling and annotating the cp genome
cpDNA was isolated from the L. perenne cultivar Cashel following a protocol from Diekmann et al.20Go Approximately 400 g of 3-week-old leaf material derived from ca. 200 g of a heterozygous Cashel seed population was used. Sequencing of the cpDNA was sourced to a commercial company (GATC Biotech/Germany). A shotgun sequencing approach was used resulting in 2179 trace files. A pre-assembly was carried out with the program PHRAP (http://www.phrap.org/index.html). The final assembly was based on the contiguous sequences obtained from PHRAP and done in comparison with the cpDNA sequence of Agrostis stolonifera (bentgrass).21Go For three genome regions with low coverage, primers were designed to re-sequence these regions (trnL-trnF: forward primer (FP): AGTTGTGAGGGTTC AAGTCC and reverse primer (RP): GAACTGGTGACACGAGGATT; atpB: FP: GTTCGTTGCCAACAATCCTA and RP: AGGTAGCTCTAGTCTATGGC; atpB-rbcL: FP: TGTGGAAGATCTGTGCCTAC and RP: GCTGAGGAGTTACTCGGAAT).

The annotation of the cp genome was based on two online available programs: DOGMA (http://dogma.ccbb.utexas.edu/) and tRNA-Scan SE (http://lowelab.ucsc.edu/tRNAscan-SE/) using the default settings. Intron positions were determined following Sugita and Sugiura.22Go The circular cp genome map was drawn using the GenomeVx program.23Go Differences between the available cp genomes were analysed based on gene, intergenic spacer (IGS) and intron lengths which were extracted from the published cp genome sequences (A. stolonifera: EF115543 [GenBank] ; Brachypodium distachyon: EU325680 [GenBank] ; Hordeum vulgare: EF115541 [GenBank] ; Oryza nivara: AP006728 [GenBank] ; Oryza sativa indica: AY522329 [GenBank] ; Oryza sativa japonica: X15901 [GenBank] ; Sorghum bicolor: EF115542 [GenBank] ; Saccharum officinarum: AP006714 [GenBank] ; Triticum aestivum: AB042240 [GenBank] ; Zea mays: X86563 [GenBank] ).

2.2. SNP and indel analysis
Because the cpDNA had been extracted from a population of plants belonging to the cultivar Cashel, several SNPs and indels could be detected. A thorough SNP and indel analysis was carried out by manually checking the alignment of the read and trace files from which the genome assembly was undertaken using the programme Lasergene (DNAstar, Inc., Madison, Wisconsin). Only SNPs and indels supported by trace files with low background and clear, distinguishable peaks were recorded. Indels were only taken into account if they were supported by at least two trace files and not located in coding regions where they would cause a frame shift. This way the possibility of cloning and sequencing artefacts was considered.

2.3. RNA editing analysis
Thirty-three genes (atpA, atpB, atpF, clpP, matK, ndhA, ndhB, ndhD, ndhF, ndhG, ndhI, ndhK, petA, petB, psaA, psaB, psaJ, psbC, psbD, psbE, psbJ, psbL, psbZ, rpl2, rpl20, rpoA, rpoB, rpoC1, rpoC2, rps14, rps2, rps8, ycf3) were analysed for RNA editing sites. Of these, 22 were chosen for study because they had been previously reported to be edited in other monocot plants,24Go–28Go and 11 were included because of observed differences from existing expressed sequence tags (EST) in Poaceae,21Go but no information was previously available for Lolium. Primers (Supplementary Table S1) for these genes were designed using Primer Express (version 2.0, Applied Biosystems, Foster City, CA, USA) and Primer3 software (http://frodo.wi.mit.edu/). For genes > 700 bp, several primer pairs were designed to cover the complete gene region. Primers were designed in the untranslated regions (UTR) to ensure complete coverage of genes. Since the length of the UTR of genes was not known, the primers were designed in the 30 bp region before and after each gene.

cDNA was used as template for the RT–PCRs. Total RNA was extracted using TRI Reagent® Solution (Ambion Inc., Austin, TX, USA) following the supplier's protocol (http://www.ambion.com/techlib/prot/bp_9738.pdf) with the following modifications: the incubation of the homogenate was extended to 10 min; instead of 100 µl bromochloropropane, 200 µl of ice cold chloroform was used; the steps including the addition of ice cold chloroform, followed by incubation at room temperature and centrifugation at 12 000g were repeated once; in addition to the 500 µl isopropanol, 0.5 µl Glycogen (Sigma-Aldrich, St Louis, Missouri, USA) was added to enhance the RNA yield; the centrifugation following the addition of isopropanol was extended to 10 min. The RNA was finally dissolved in nuclease free water and treated with DNA-freeTM (Ambion Inc., Austin, TX, USA) following the manufacturer's instructions to remove possible DNA contamination. First strand cDNA was synthesized using SuperScriptTM III Reverse Transcriptase (InvitrogenTM Corporation, Carlsbad, CA, USA) following the manufacturer's instructions.

For each gene region, two independent RT–PCR reactions were set up using the following components per 30 µl PCR reaction: 3 µl cDNA, 3 µl 10 x Thermo Buffer (New England Biolabs, Inc., Ipswich, MA, USA), 0.6 µl FP, 0.6 µl RP, 0.6 µl dNTPs (metabion international AG, Martinsried, Germany) (10 mM), 21.9 µl ddH2O, 0.3 µl Taq-Polymerase (New England Biolabs, Inc.). The PCR programme settings were 95°C 5 min, (95°C 1 min, 55°C 1 min, 72°C 1 min) 35 cycles, 72°C 10 min. The annealing temperature was adjusted according to the optimal primer requirements. The resulting RT–PCR products were sequenced twice using both forward and reverse primers. The analysis of the editing sites was carried out in MEGA 3.129Go by aligning the cDNA sequence results with the corresponding DNA sequences and checking visually for SNPs.


    3. Results and discussion
 Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results and discussion
 Supplementary data
 Funding
 Acknowledgements
 References
 
Using the shotgun sequencing approach an average eightfold genome coverage was achieved. The cp genome of L. perenne has a total length of 135 282 bp with a quadripartite structure typical of angiosperms. The LSC region consists of 79 972 bp, the SSC of 12 428 bp and the IRs of 21 441 bp each (Fig. 1). The genome has a GC content of 38% and codes for 128 genes of which 18 are duplicated in the IR region. The genome contains 264 simple sequence repeats (SSRs) with mononucleotide repeats of 7–16 bp in length. The cp genome sequence of L. perenne is deposited at the European Molecular Biology Laboratory under Accession number AM777385.


Figure 1
View larger version (23K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 1. Circular structure of the chloroplast genome of Lolium perenne. Genes written on the outside are transcribed clockwise, genes on the inside counter-clockwise, annotated genes are colour coded according to their function, genes containing introns are highlighted with an asterisk; LSC, large single copy region; SSC, small single copy region; IR, inverted repeat.

 
3.1. Comparison to other species
The average size of publicly available Poaceae cp genomes is 137 091 bp. The subfamily Ehrhartoideae has the smallest genome with an average size of 134 505 bp; subfamily Panicoideae has the largest genome with an average size of 140 876 bp. The subfamily Pooideae, to which L. perenne belongs, has an average size of 135 614 bp. Thus L. perenne is of average size within Pooideae and of medium size within Poaceae (Fig. 2).


Figure 2
View larger version (18K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 2. Chloroplast genome sizes of 11 different Poaceae species grouped by taxonomic sub-families.

 
The gene content and intron content of L. perenne cpDNA are the same as that of other grasses,21Go,24Go,27Go,30Go,31Go,32Go with 76 protein-coding genes, 30 tRNA genes and four rRNA genes. Eighteen genes are completely duplicated within the IR, as are the 3' exons of the trans-spliced gene rps12 and the 5' part of ndhH which overlaps the IR/SSC junctions. When compared with the standard set of genes in angiosperm cp genomes, the genes accD, ycf1 and ycf2 are absent. After our analysis was completed, the cp genome sequence of the very closely related species Festuca arundinacea became available in GenBank (Cahoon et al., unpublished data; accession number FJ466687 [GenBank] ). Rather surprisingly, in addition to the expected absences of accD, ycf1 and ycf2, the Festuca sequence also lacks intact copies of the genes psbF, rps14, rps18 and ycf4. All four of these genes are intact and apparently functional in L. perenne.

Differences in the cp genome size of L. perenne compared with other Poaceae species are mainly due to length variations of IGS regions and introns (Table 1) and this finding was consistent with previous observations.27Go,32Go The length of IGS regions and introns varies widely from only a few base pairs up to several hundred. Twenty-five IGS regions and four introns were found to vary in length by more than 100 bp (Table 1). The highest variation in size (given in brackets) was found in the trnI-CAUtrnL-CAA IGS (2135 bp), the trnG-UCCtrnT-GGU IGS (1231 bp) and the rbcL–psaI IGS (1221 bp). The trnI-CAU–trnL-CAA IGS and rbcL–psaI IGS are sites that contain pseudogenes for ycf2 and accD, respectively, in Poaceae.27Go Both these pseudogenes and a ycf1 pseudogene were detected in L. perenne. The trnG-UCC - trnT-GGU IGS is part of a ‘divergence hotspot’ described by Maier et al.27Go whose variability is caused by a large number of deletion/insertion events.


View this table:
[in this window]
[in a new window]

 
Table 1. Length variation of > 100 bp for intergenic spacer and intron regions in Poaceae chloroplast genomes

 
A comparison between L. perenne and the other Poaceae species showed differences in gene length for 26 genes (Table 2). The majority of these genes is in the LSC region. Length variations of more than ten codons were observed in eight genes (codon variation): matK (31), ndhK (21), petB (19), rpoC2 (68), rps3 (15), rps15 (12), rps16 (27) and rps18 (14). The variation in gene length for the rpoC2 gene was more than twice that found in any other gene. L. perenne and A. stolonifera have the shortest rpoC2 genes (each 4 401 bp). The rps18 gene in L. perenne is up to 14 codons shorter than in the other species. The ndhK and rps16 genes are 21 and 27 codons, respectively, longer in L. perenne than in O. nivara.


View this table:
[in this window]
[in a new window]

 
Table 2. Variation in length of different chloroplast genes

 
The length variations observed in rps18 and rpoC2 are noteworthy. In both cases, L. perenne showed the shortest of all sequences. Sequence variation between monocots and dicots for rps18 has been described by Weglöhner et al.,33Go based on the occurrence of different numbers of the heptapeptide repeat SKQPFRK near the N terminus of the protein. Our study revealed that length differences among Poaceae rps18 sequences are mainly based on the same heptapeptide repeat (S/F)K(Q/K)(P/T)F(R/L/H/S/N)(K/R) as described by Weglöhner et al.33Go (Supplementary Fig. S1). This motif is present six times in rps18 of L. perenne, B. distachyon, O. sativa, O. nivara, S. bicolor and S. officinarum and seven times in rps18 of A. stolonifera, H. vulgare, T. aestivum and Z. mays. The L. perenne rps18 gene is the shortest detected so far, because it has undergone an additional deletion of seven amino acids near its C terminus. The deletions do not result in the creation of stop codons and we expect the L. perenne rps18 gene to be functional.

The largest length variation in Poaceae genes was found in rpoC2, of up to 68 codons difference between L. perenne and S. officinarum, and is due to several insertion/deletion events (data not shown). Comparisons of the rpoC2 gene from dicots and monocots revealed that Poaceae have a unique insertion of ~400 bp in the middle of this gene.34Go–36Go Cummings et al.36Go demonstrated that this region is highly variable compared with its flanking regions and is rich with tandem repeats. Nearly, all the variations found between L. perenne and the panicoids are located in this specific insertion region. Analysing cytoplasmic male sterile (CMS) lines of Sorghum, Chen et al.37Go discovered a 165 bp deletion in this insertion region that suggests a possible relation between this deletion in rpoC2 and the CMS-system.38Go So far this deletion was only observed in Sorghum but sequence comparisons (data not shown) revealed that one deletion that results in the shorter L. perenne rpoC2 gene is located in the same region where the deletion occurs in Sorghum. Hence a higher susceptibility to variation in this gene region could be indicated and an investigation of L. perenne CMS lines in regard to variation to fertile lines may prove valuable for improving future Lolium breeding schemes.

3.2. Indel/SNP analysis
A total of 10 indels (Table 3) and 40 SNPs (Table 4) were found to be polymorphic among our sequencing reads. All indels are located in intergenic regions. Indels occurred in microsatellite regions, resulting in both shortening (one occurrence) and lengthening (nine occurrences) of the sequenced region compared with the length that was observed in the majority of the trace files. Knowledge gained about the sequence variability of these regions can be used to design primers around those microsatellites for population genetic and phylogenetic studies and can be also used to support breeding schemes via defining cytoplasmic breeding pools. This will be of especially high value for breeding schemes based on interspecific crosses between Lolium and Festuca.


View this table:
[in this window]
[in a new window]

 
Table 3. Indels observed in the cp genome of Lolium perenne

 


View this table:
[in this window]
[in a new window]

 
Table 4. Single nucleotide polymorphisms in the chloroplast genome of Lolium perenne

 
Nineteen SNPs were found within IGS regions and introns and 21 within coding regions (Table 4). Most of the SNPs are due to transition mutations (20 A{leftrightarrow}G and 8 C{leftrightarrow}T), with 12 transversions. Closer analysis of the SNPs found at position 100 655 and 100 656 (trnN-rps15 IGS) revealed that these SNPs are caused by a tiny inversion of two nucleotides which are flanked by an IR of 29 bp length forming a stable hairpin secondary structure (Fig. 3). The small inversion of TG within the trnN-rps15 region in the IR is found in 13 of the 29 trace files covering the region. We also noticed another small inversion that was supported by only one sequence read and caused SNPs at position 18, 20, 21 and 23 (rps19-psbA IGS). This inversion spans six nucleotides (TTCTAG) that are flanked by an IR of 25 bp length (Fig. 3).


Figure 3
View larger version (21K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 3. Two hairpin loops found in the chloroplast genome of Lolium perenne.

 
Small inversions like the ones revealed by our study have been found between species,39Go,40Go between genera39Go,41Go and also within populations of one other species, the conifer Abies.42Go The two inversions found in the current study lead, together with the level of observed SNPs, to the conclusion that the cp genome of L. perenne cv Cashel consists of at least two haplotypes but potentially scores more. McGrath et al.16Go detected five haplotypes in 16 individuals of Cashel using a set of ten primers43Go amplifying eight different regions in the cp genome and sizing the PCR products. Eight maternal lines were included in breeding Cashel (Vincent Connolly, personal communication). Thus further analyses based on DNA sequences could reveal up to eight haplotypes, differing by SNPs and indels that include the ones found in this study.

Although cp genomes are known to be highly conserved, similar observations of intraspecific cp DNA variation have been recorded in other species.21Go,44Go,45Go However, this is the only study we know of that has quantified SNP variation of the whole cp genome within a cultivar. Most studies of cp DNA variation within a species have assessed populations of individuals with a limited number of markers, from a few selected gene regions or have sampled wild populations. Tsumura et al.42Go studied natural populations of Abies and also detected many minor variations like indels and inversions within species. Although some of the apparent SNPs that were only present in one sequencing read might be due to cloning artefacts, the current results are not surprising in view of the fact that L. perenne is an outcrossing species and the cultivar we used for sequencing is based on a population of several maternal lines and is thus heterogeneous and heterozygous. However, to discover this extent of SNP variation within a single cultivar of Lolium was surprising.

3.3. RNA editing sites
In total, 31 RNA editing sites were detected in 18 genes (Table 5). All editing sites are C to U changes. Most frequently, editing results in changes of the amino acid from serine or proline to leucine. Four editing sites (ndhA, site 4; ndhG, 5' UTR; rpoB, site 4; rps14), which were previously observed in other Poaceae species, were not edited in L. perenne. For three of them, the conserved nucleotide U exists already at the DNA level. Site 4 in rpoB is not edited, although C is encoded in the DNA.


View this table:
[in this window]
[in a new window]

 
Table 5. RNA editing sites found in the chloroplast genome of Lolium perenne in comparison with the editing sites found in other monocots

 
Analysis of editing in the ndhA gene was not completed because several primers failed to amplify and the obtained sequencing products did not have the full gene length. Thus site 4, which was observed in O. sativa, S. officinarum and Z. mays, could not be analysed. However, in L. perenne this position is a TTC (phenylalanine) codon, which is the same as the codon that is formed by mRNA editing in the three other species. Thus editing is unlikely to happen at this position in L. perenne.

The editing analysis revealed five new editing sites that are so far unique to L. perenne. Four of these sites are in three genes (ndhK, psbJ, psbL) in which editing has never been reported before in Poaceae species. Two of the five new editing sites are synonymous but three result in changes of the amino acid to leucine.

Partial editing was observed at eight editing sites (six genes). In most of these editing sites, the amount of incompletely edited transcripts is small. However, approximately one-half and one-third of the matK and psbL transcripts, respectively, are not edited.

This study of RNA editing sites in the cp genome of L. perenne demonstrates that predicting editing sites based solely on published EST sequences is not sufficient. Timme et al.45Go also showed that editing sites can be easily overlooked, or SNPs can be falsely interpreted as editing sites, using that approach. For example only six of the genes analysed via EST comparisons by Saski et al.21Go have had editing sites experimentally confirmed in other species. The SNPs found in EST sequences by Saski et al.21Go were in general not based on C–U changes and thus are highly unlikely to be editing sites. Most of the SNPs found by comparing ESTs to cpDNA sequences will be based on the use of different varieties, or on poor quality sequencing data. Our approach of analysing SNPs and editing sites in the same variety of L. perenne ensured that newly detected sites with either complete or partial editing were evaluated correctly as editing sites and not accidentally mistaken as SNPs or vice versa.


    Supplementary data
 Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results and discussion
 Supplementary data
 Funding
 Acknowledgements
 References
 
Supplementary data are available at www.dnaresearch.oxfordjournals.org.


    Funding
 Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results and discussion
 Supplementary data
 Funding
 Acknowledgements
 References
 
The project funding was obtained from the Teagasc ‘Vision’ programme.


    Acknowledgements
 Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results and discussion
 Supplementary data
 Funding
 Acknowledgements
 References
 
We thank Dr Jiri Ködding and Dr Gavin Conant for all their support while sequencing, assembling and annotating the chloroplast genome. K.H.W. is supported by Science Foundation Ireland. K.D. and R.vdB. were financed under the Teagasc Walsh Fellowship Scheme.


    Footnotes
 
* To whom correspondence should be addressed. Tel. +353 59-9170-243. Fax. +353 59-9142-423. E-mail: kerstin.diekmann{at}teagasc.ie

Edited by Satoshi Tabata


    References
 Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results and discussion
 Supplementary data
 Funding
 Acknowledgements
 References
 

  1. Gray M. W. The evolutionary origins of plant organelles. In: Molecular Biology and Biotechnology of Plant Organelles—Daniell, Chase H., eds. (2004) Dordrecht: Springer. 87–108.
  2. Keeling P. J. Diversity and evolutionary history of plastids and their hosts. Am. J. Bot. (2004) 91:1481–1493.[Abstract/Free Full Text]
  3. Margulis L. Origin of eukaryotic cells. (1970) New Haven: Yale University Press.
  4. Lilly J. W., Havey M. J., Jackson S. A., Jiang J. Cytogenomic analyses reveal the structural plasticity of the chloroplast genome in higher plants. Plant Cell (2001) 13:245–54.[Abstract/Free Full Text]
  5. Sugiura M. The chloroplast genome. Plant Mol. Biol. (1992) 19:149–68.[CrossRef][Web of Science][Medline]
  6. Palmer J. D. Chloroplast DNA evolution and biosystematic uses of chloroplast DNA variation. Am. Nat. (1987) 130:S6.[CrossRef]
  7. Corriveau J. L., Coleman A. W. Rapid screening method to detect potential biparental inheritance of plastid DNA and results for over 200 angiosperm species. Am. J. Bot. (1988) 75:1443–1458.[CrossRef][Web of Science]
  8. Säll T., Jakobsson M., Lind-Halldén C., Halldén C. Chloroplast DNA indicates a single origin of the allotetraploid Arabidopsis suecica. J. Evol. Biol. (2003) 16:1019–29.[CrossRef][Web of Science][Medline]
  9. Daniell H., Datta R., Varma S., Gray S., Lee S. B. Containment of herbicide resistance through genetic engineering of the chloroplast genome. Nat. Biotechnol. (1998) 16:345–348.[CrossRef][Web of Science][Medline]
  10. Wu F. -H., Kan D. -P., Lee S. -B., et al. Complete nucleotide sequence of Dendrocalamus latiflorus and Bambusa oldhamii chloroplast genomes. Tree Physiol. (2009) doi:10.1093/treephys/tpp015.
  11. Hodkinson T. R., Waldren S., Parnell J. A. N., Kelleher C. T., Salamin K., Salamin N. DNA banking for plant breeding, biotechnology and biodiversity evaluation. J. Plant Res. (2007) 120:17–29.[CrossRef][Web of Science][Medline]
  12. Sato S., Nakamura Y., Kaneko T., Asamizu E., Tabata S. Complete structure of the chloroplast genome of Arabidopsis thaliana. DNA Res. (1999) 6:283–90.[Abstract]
  13. Yukawa M., Tsudzuki T., Sugiura M. The chloroplast genome of Nicotiana sylvestris and Nicotiana tomentosiformis: complete sequencing confirms that the Nicotiana sylvestris progenitor is the maternal genome donor of Nicotiana tabacum. Mol. Genet. Genomics (2006) 275:367–73.[CrossRef][Web of Science][Medline]
  14. Jansen R. K., Raubeson L. A., Boore J. L., et al. Methods for obtaining and analyzing whole chloroplast genome sequences. Methods Enzymol. (2005) 395:348–84.[CrossRef][Web of Science][Medline]
  15. Chung S. M., Gordon V. S., Staub J. E. Sequencing cucumber (Cucumis sativus L.) chloroplast genomes identifies differences between chilling—tolerant and—susceptible cucumber lines. Genome (2007) 50:215–25.[Medline]
  16. McGrath S., Hodkinson T. R., Barth S. Extremely high cytoplasmic diversity in natural and breeding populations of Lolium (Poaceae). Heredity (2007) 99:531–44.[CrossRef][Web of Science][Medline]
  17. Bock R. Sense from nonsense: how the genetic information of chloroplasts is altered by RNA editing. Biochimie (2000) 82:549–57.[CrossRef][Web of Science][Medline]
  18. Tsudzuki T., Wakasugi T., Sugiura M. Comparative analysis of RNA editing sites in higher plant chloroplasts. J. Mol. Evol. (2001) 53:327–32.[CrossRef][Web of Science][Medline]
  19. Hoch B., Maier R. M., Appel K., Igloi G. L., Kössel H. Editing of a chloroplast mRNA by creation of an initiation codon. Nature (1991) 353:178–80.[CrossRef][Medline]
  20. Diekmann K., Hodkinson T. R., Fricke E., Barth S. An optimized chloroplast DNA extraction protocol for grasses (Poaceae) proves suitable for whole plastid genome sequencing and SNP detection. PLoS ONE (2008) 3:e2813.[CrossRef][Medline]
  21. Saski C., Lee S. B., Fjellheim S., et al. Complete chloroplast genome sequences of Hordeum vulgare, Sorghum bicolor and Agrostis stolonifera, and comparative analyses with other grass genomes. Theor. Appl. Genet. (2007) 115:591.[CrossRef]
  22. Sugita M., Sugiura M. Regulation of gene expression in chloroplasts of higher plants. Plant Mol. Biol (1996) 32:315–26.[CrossRef][Web of Science][Medline]
  23. Conant G. C., Wolfe K. H. GenomeVx: simple web-based creation of editable circular chromosome maps. Bioinformatics (2008) 24:861–2.[Abstract/Free Full Text]
  24. Calsa Júnior T., Carraro D. M., Benatti M. R., Barbosa A. C., Kitajima J. P., Carrer H. Structural features and transcript-editing analysis of sugarcane (Saccharum officinarum L.) chloroplast genome. Curr. Genet (2004) 46:366–73.[CrossRef][Web of Science][Medline]
  25. Corneille S., Lutz K., Maliga P. Conservation of RNA editing between rice and maize plastids: are most editing events dispensable. Mol. Gen. Genet. (2000) 264:419–24.[CrossRef][Web of Science][Medline]
  26. Freyer R., Hoch B., Neckermann K., Maier R. M., Kössel H. RNA editing in maize chloroplasts is a processing step independent of splicing and cleavage to monocistronic mRNAs. Plant J. (1993) 4:621–9.[CrossRef][Web of Science][Medline]
  27. Maier R. M., Neckermann K., Igloi G. L., Kössel H. Complete sequence of the maize chloroplast genome: gene content, hotspots of divergence and fine tuning of genetic information by transcript editing. J. Mol. Biol. (1995) 251:614–28.[CrossRef][Web of Science][Medline]
  28. Zeltz P., Hess W. R., Neckermann K., Börner T., Kössel H. Editing of the chloroplast rpoB transcript is independent of chloroplast translation and shows different patterns in barley and maize. EMBO J. (1993) 12:4291–6.[Web of Science][Medline]
  29. Kumar S., Tamura K., Nei M. MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief. Bioinform. (2004) 5:150–63.[Abstract/Free Full Text]
  30. Ogihara Y., Isono K., Kojima T., et al. Structural features of a wheat plastome as revealed by complete sequencing of chloroplast DNA. Mol. Genet. Genomics (2002) 266:740–6.[CrossRef][Web of Science][Medline]
  31. Bortiri E., Coleman-Derr D., Lazo G. R., Anderson O. D., Gu Y. Q. The complete chloroplast genome sequence of Brachypodium distachyon: sequence comparison and phylogenetic analysis of eight grass plastomes. BMC Res. Notes (2008) 31:61.
  32. Palmer J. D. Plastid chromosomes: structure and evolution. In: Cell Culture and Somatic Cell Genetics of Plants, vol 7A, The Molecular Biology of Plastids—Vasil I. K., Bogorad L., eds. (1991) San Diego: Academic Press. 5–53.
  33. Weglöhner W., Subramanian A. R. A heptapeptide repeat contributes to the unusual length of chloroplast ribosomal protein S18. Nucleotide sequence and map position of the rpl33-rps18 gene cluster in maize. FEBS Lett. (1991) 279:193–7.[CrossRef][Web of Science][Medline]
  34. Igloi G. L., Meinke A., Döry I., Kössel H. Nucleotide sequence of the maize chloroplast rpo B/C1/C2 operon: comparison between the derived protein primary structures from various organisms with respect to functional domains. Mol. Gen. Genet. (1990) 221:379–94.[Web of Science][Medline]
  35. Shimada H., Fukuta M., Ishikawa M., Sugiura M. Rice chloroplast RNA polymerase genes: the absence of an intron in rpoC1 and the presence of an extra sequence in rpoC. Mol. Gen. Genet. (1990) 221:395–402.[Web of Science][Medline]
  36. Cummings M. P., King L. M., Kellogg E. A. Slipped-strand mispairing in a plastid gene: rpoC2 in grasses (Poaceae). Mol. Biol. Evol. (1994) 11:1–8.[Abstract]
  37. Chen Z., Muthukrishnan S., Liang G. H., Schertz K. F., Hart G. E. A chloroplast DNA deletion located in RNA polymerase gene rpoC2 in CMS lines of sorghum. Mol. Gen. Genet. (1993) 236:251–9.[CrossRef][Web of Science][Medline]
  38. Chen Z., Schertz K. F., Mullet J. E., DuBell A., Hart G. E. Characterization and expression of rpoC2 in CMS and fertile lines of sorghum. Plant Mol. Biol. (1995) 28:799–809.[CrossRef][Web of Science][Medline]
  39. Kim K. J., Lee H. L. Complete chloroplast genome sequences from Korean Ginseng (Panax schinseng Nees) and comparative analysis of sequence evolution among 17 vascular plants. DNA Res. (2004) 11:247–261.[Abstract]
  40. Kim K. J., Lee H. L. Widespread occurrence of small inversions in the chloroplast genomes of land plants. Mol. Cells (2005) 19:104–13.[Web of Science][Medline]
  41. Kelchner S. A., Wendel J. F. Hairpins create minute inversions in non- coding regions of chloroplast DNA. Curr. Genet (1996) 30:259–62.[CrossRef][Web of Science][Medline]
  42. Tsumura Y., Suyama Y., Yoshimura K. Chloroplast DNA inversion polymorphism in populations of Abies and Tsuga. Mol. Biol. Evol. (2000) 17:1302–12.[Abstract/Free Full Text]
  43. McGrath S., Hodkinson T. R., Salamin N., Barth S. Development and testing of novel chloroplast microsatellite markers for Lolium perenne and other grasses (Poaceae) from de novo sequencing and in silico sequences. Mol. Ecol. Notes (2006) 6:449–452(4).[CrossRef][Web of Science]
  44. Daniell H., Lee S. B., Grevich J., et al. Complete chloroplast genome sequences of Solanum bulbocastanum, Solanum lycopersicum and comparative analyses with other Solanaceae genomes. Theor. Appl. Genet. (2006) 112:1503–18.[CrossRef][Web of Science][Medline]
  45. Timme R. E., Kuehl J. V., Boore J. L., Jansen R. K. A comparative analysis of the Lactuca and Helianthus (Asteraceae) plastid genomes: identification of divergent regions and categorization of shared repeats. Am. J. Bot. (2007) 94:302–312.[Abstract/Free Full Text]
  46. Vogel J., Hübschmann T., Börner T., Hess W. R. Splicing and intron- internal RNA editing of trnKmatK transcripts in barley plastids: support for matK as an essential splice factor. J. Mol. Biol. (1997) 270:179–87.[CrossRef][Web of Science][Medline]
  47. Lopez C., Freyer R., Guera A., et al. Sequence of ndhA gene of barley (Hordeum vulgare L.) plastid (accession nos. Y13729 & Y13730). Transcript editing in Graminean organs. Plant Physiol. (1997) 115:313.[CrossRef][Medline]
  48. del Campo E. M., Sabater B., Martin M. Plastid ndhD gene of barley (Hordeum vulgare L.), sequence and transcript editing (Accession no. Y12258). Plant Physiol. (1997) 114:748.[Web of Science]
  49. Drescher A., Hupfer H., Nickel C., et al. C-to-U conversion in the intercistronic ndhI/ ndhG RNA of plastids from monocot plants: conventional editing in an unconventional small reading frame. Mol. Genet. Genomics (2002) 267:262–9.[CrossRef][Web of Science][Medline]
  50. Inada M., Sasaki T., Yukawa M., Tsudzuki T., Sugiura M. A systematic search for RNA editing sites in pea chloroplasts: an editing event causes diversification from the evolutionarily conserved amino acid sequence. Plant Cell Physiol. (2004) 45:1615–22.[Abstract/Free Full Text]
  51. Ruf S., Kössel H. Tissue-specific and differential editing of the two ycf3 editing sites in maize plastids. Curr. Genet. (1997) 32:19–23.[CrossRef][Web of Science][Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Data
Right arrowOA All Versions of this Article:
16/3/165    most recent
dsp008v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Request Permissions
Google Scholar
Right arrow Articles by Diekmann, K.
Right arrow Articles by Barth, S.
PubMed
Right arrow PubMed Citation
Right arrow Articles by Diekmann, K.
Right arrow Articles by Barth, S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?