DNA Research Advance Access originally published online on December 1, 2007
DNA Research 2007 14(5):227-233; doi:10.1093/dnares/dsm022
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Specific Enrichment of miRNAs in Arabidopsis thaliana Infected with Tobacco mosaic virus
1 Department of Life Sciences, Graduate School of Arts and Sciences, The University of Tokyo, Komaba 3-8-1, Meguro, Tokyo 153-8902, Japan
2 Department of Integrated Biosciences, Graduate School of Frontier Sciences, The University of Tokyo, Kashiwanoha, Kashiwa, Chiba 277-8562, Japan
3 RIKEN Plant Science Center, Suehiro-cho 1-7-22, Tsurumi-ku, Yokohama, Kanagawa 230-0045, Japan
Received 28 May 2007; accepted 6 November 2007.
| Abstract |
|---|
|
|
|---|
RNA silencing is a broadly conserved machinery and is involved in many biological events. Small RNAs are key molecules in RNA silencing pathway that guide sequence-specific gene regulations and chromatin modifications. The silencing machinery works as an anti-viral defense in virus-infected plants. It is generally accepted that virus-specific small interfering (si) RNAs bind to the viral genome and trigger its cleavage. Previously, we have cloned and obtained sequences of small RNAs from Arabidopsis thaliana infected or uninfected with crucifer Tobacco mosaic virus. MicroRNAs (miRNAs) accumulated to a higher percentage of total small RNAs in the virus-infected plants. This was partly because the viral replication protein binds to the miRNA/miRNA* duplexes. In the present study, we mapped the sequences of small RNAs other than virus-derived siRNAs to the Arabidopsis genome and assigned each small RNA. It was demonstrated that only miRNAs increased as a result of viral infection. Furthermore, some newly identified miRNAs and miRNA candidates were found from the virus-infected plants despite a limited number of examined sequences. We propose that it is advantageous to use virus-infected plants as a source for cloning and identifying new miRNAs.
Key words: Arabidopsis thaliana; Tobacco mosaic virus; microRNA; RNA silencing
| 1. Introduction |
|---|
|
|
|---|
Small RNAs play important roles in RNA silencing mechanisms which are involved in many biological processes in eukaryotes. These small RNAs guide post-transcriptional gene silencing by inhibiting translation or degrading the target mRNAs, and guide transcriptional gene silencing by modifying chromatin.1
In Arabidopsis thaliana, functional small RNAs are mostly 21–24 nt long. The best-studied endogenous small RNAs are microRNAs (miRNAs). In Arabidopsis, miRNAs are excised from primary miRNA transcripts forming stem-loop structures by the RNase III enzyme DICER-LIKE 1 (DCL1). This enzyme works coordinately with HYL1 and SERRATE to produce miRNA/miRNA* duplexes.4
–9
miRNAs are loaded into the RNA-induced silencing complex (RISC) where the complementary mRNAs are cleaved by ARGONAUTE 1 (AGO1), which has Slicer activity.10
,11
Plants have some unique small RNAs in addition to miRNA. Trans-acting siRNA (tasiRNA) is produced from long double-stranded RNA (dsRNA) by DCL4 with its binding partner, DRB4.12
–14
miRNA and tasiRNA are mainly involved in plant development, response to environmental stresses and so on through regulating gene expression.1
–3
siRNAs derived from natural-antisense transcripts (nat-siRNAs) exist in Arabidopsis and function in the stress response and bacterial disease resistance.15
,16
However, the numbers and functions of nat-siRNAs are not fully understood.
The RNA silencing pathway also serves as an anti-viral defense in plants. Viral genome-derived siRNAs are detected in plants infected with RNA viruses17
,18
and DNA viruses.19
,20
The lengths of these siRNAs differ with the type of viruses,18
,21
suggesting the involvement of different DCLs in producing the respective viral siRNAs. It is conceived that the resulting siRNAs are loaded into the RISC as well as endogenous small RNAs, bind the viral genome through complementary sequences and direct the degradation of the viral genome. To counteract the silencing machinery of plants, many viruses have evolved genes which encode silencing suppressor proteins with distinct properties.22
,23
Many suppressors have dsRNA binding activity so that virus siRNAs are trapped, resulting in inhibition of the silencing machinery.24
,25
In contrast to the dsRNA binding strategy, the Cucumber mosaic virus-encoded 2b protein directly interacts with AGO1 and inhibits its activity26
and Turnip crinkle virus-encoded P38 protein suppresses DCL4 activity.18
We have examined the crucifer Tobacco mosaic virus-Cg (TMV-Cg) infection of Arabidopsis as a model system to study plant-Tobamovirus interaction.27
,28
TMV-Cg is a positive-sense, single-stranded RNA virus. We have previously cloned and sequenced small RNAs from Arabidopsis infected or uninfected with TMV-Cg and demonstrated that miRNAs increased in the virus-infected plants.28
In TMV and Tomato mosaic virus (ToMV), which both belong to the Tobamovirus family, 126K replication proteins suppress RNA silencing.29
,30
Thus, it is postulated that the 126K replication protein of TMV-Cg also acts as a silencing suppressor because it binds to small dsRNAs.28
Owing to this activity, 126K replication protein binds to miRNA/miRNA* duplexes, resulting in the accumulation of miRNAs. In the present study, we examined all small RNA sequences obtained from Arabidopsis infected or uninfected with TMV-Cg. We then mapped the region where each small RNA sequence was derived in the Arabidopsis genome. Among the small RNAs from virus-infected plants, we identified several newly identified miRNAs and miRNA candidates. Virus-infected plants could be an effective source to find novel miRNAs.
| 2. Materials and methods |
|---|
|
|
|---|
2.1. Mapping of small RNAs using BLAST searches
We have analyzed small RNA sequences obtained previously; 1700 and 543 reads from the leaves of Arabidopsis infected and uninfected with TMV-Cg at 3 days post-infection (dpi), respectively.28
2.2. Other computational analyses
Secondary structures of miRNA precursors were predicted using the mFOLD program (http://www.bioinfo.rpi.edu/applications/mfold/).32
Targets of miRNAs were predicted using the miRU: Plant microRNA Potential Target Finder (http://bioinfo3.noble.org/miRNA/miRU.htm).33
To compare the ratio of our sequences to that of other databases, each sequence was searched against the Arabidopsis MPSS Plus Database (http://mpss.udel.edu/at/)34
and the Arabidopsis Small RNA Project (ASRP) (http://asrp.cgrb.oregonstate.edu/).35
In Table 2, miRNAs were searched against 4Co10 (Co1-0 wildtype inflorescence tissues, small RNA 454) in MPSS and Co1-0 (Leaf, Inflorescence) in ASRP. In Fig. 2, small RNA sequences were searched against all datasets in both databases.
2.3. Plant materials and virus inoculation
The following Arabidopsis plants were used; Col-0 (wild type), dcl1-9 (BC6), dcl2-2 (SALK_123586), dcl3-1 (SALK_005512) and dcl4-1 (BC6). Dr Herve Vaucheret (INRA, France) kindly provided dcl1-9 (BC6) and dcl4-1 (BC6), which were backcrossed to Col-0 six times. All plants were grown in a growth chamber at 22°C with photoperiod of 16 h. For the virus inoculation, leaves of 4-week-old plants were dusted with carborundum and gently rubbed with 20 µg/mL of TMV-Cg solution. For mock inoculation, TMV-Cg solution was replaced with 10 mM sodium phosphate buffer.
2.4. Northern blot analysis
Total RNA was extracted at 10 dpi from the inoculated leaves, mock-inoculated leaves and inflorescences of Arabidopsis using ISOGEN reagent (Nippon gene). Aliquots of 10 µg of total RNA were loaded and resolved on a denaturing 15% polyacrylamide gel (7 M urea). To make the miR847(5') probe, oligonucleotide (TCGGCTTCCCATTCCTCTTCA) was 5' end-labeled with [
-32
P] ATP using T4 polynucleotide kinase (TOYOBO). Hybridization was carried out at 40°C using PerfectHyb Plus hybridization buffer (Sigma). The blots were exposed on imaging plates, and signals were visualized using BAS-2500 (Fuji).
| 3. Results and discussion |
|---|
|
|
|---|
3.1. Increase of miRNAs in Arabidopsis infected with TMV-Cg
We have previously sequenced small RNAs from the leaves of Arabidopsis infected or uninfected with TMV-Cg at 3 dpi. We obtained 1700 sequences from the virus-infected plants and 543 sequences from mock-infected plants.28
|
The percentage of total miRNAs was 5.5 times higher in TMV-infected plants (25.4%) than that in mock-infected plants (4.6%) (Table 1 and Kurihara et al.28
We have recently demonstrated that the increase of miRNAs could be attributed to the activity of the viral-encoded 126K protein, which binds and therefore stabilizes miRNA/miRNA* duplexes.28
However, we found that there is no big difference between the ratios of miRNA to miRNA* in mock- and TMV-infected plants (6.6 times in mock-infected plants and 10 times in TMV-infected plants). This fact possibly indicates that there is still another mechanism of the miRNA increase or stabilization in the virus-infected plants, in addition to binding activity of 126K protein to miRNA/miRNA* duplexes.
We compared the percentage of each miRNA between mock-infected and virus-infected plants (Fig. 1). The percentages of all miRNAs except for miR160 increased as a result of virus infection. Some miRNAs showed remarkable increases, especially in miR163 (from 1.1 to 9.3%), miR164 (from 0.2 to 5.1%) and miR167 (from 0.4 to 2.7%). Most others increased 2–3 times in virus-infected plants. This result indicates that binding activity of the TMV-Cg replication protein to those miRNA/miRNA* duplexes is specifically high, or that transcription of some miRNAs is also activated.
|
Inhibition of the miRNA pathway has been reported with many other virus-infected plants and with plants transformed with viral proteins.26
3.2. Unique small RNAs in gene and intergenic regions in TMV-infected and mock-infected plants
In addition to the increase of miRNA percentage in plants infected with TMV-Cg, some miRNAs were cloned and sequenced only in the virus-infected plants (Fig. 1; indicated with circles). This led us to speculate that the virus-infected plants could be a good source for finding new miRNAs.
If there are new miRNAs in our small RNA sequence reads, they are likely to be mapped in the gene or intergenic region (Table 1). Therefore, we checked whether there are new sequences in the small RNAs mapped to the gene and intergenic regions compared with other small RNA databases; ASRP35
and MPSS34
(Fig. 2). Interestingly, not only in TMV-Cg-infected plants but also in mock-infected plants, most small RNAs were not detected in ASRP and MPSS databases and were unique to our reads, although there are 34 times more sequences in MPSS and 260 times more in ASRP than in our dataset from virus-infected plants. This is possibly due to the differences in RNA sources and cloning methods between ours and other groups' which performed deep sequencing using the 454 sequencing method. This suggests that many small RNAs remain to be discovered. They will be found if the cloning condition is changed even though the total reads are less than those using 454 sequencing. Thus, it is quite possible that there are new functional small RNAs in our resources of virus-infected and mock-infected plants. Especially in the TMV-infected plants in which many kinds of miRNAs were more abundant, we can expect new miRNA reads.
|
3.3. miRNA candidates in plants infected with TMV-Cg
Three miRNAs (miR822, miR823, and miR824) reported very recently40
|
Next, we tried to find out novel miRNAs in the small RNA data of the virus-infected plants. Before confirmation and validation of new miRNAs, we performed secondary structure predictions using the mFOLD program. We used sequences
300 nt in length from around the matched stretch where small RNAs mapped to the gene and intergenic regions. Three different sequences formed hairpin structures, which are common structures to miRNA precursors (Fig. 3 and Supplementary Fig. S2), suggesting that these sequences are candidates of miRNAs.
|
Out of them, we found that one candidate could be mapped to the 5' arm of miR847 (Fig. 3). Though it may be a variant of miR847*, it is possible that the small RNA is also functional because it has an 8 nt overhang instead of 2 nt, which the DCL product generally has (Fig. 3). Thus, we named it miR847(5') and analyzed further. In our small RNA data, there was no miR847 sequence while miR847(5') was read twice. miR847(5') was not cloned in ASRP and MPSS databases (Table 2). The other two sequences forming hairpin structures were named candidates A and B (Supplementary Fig. S2). Each of them was read once in the small RNA data from virus-infected plants.
We performed northern blot analyses to detect these miRNA candidates and confirm their expression patterns. Out of three miRNA candidates, only miR847(5') could be detected (Fig. 4). Candidates A and B were not detected.
|
miR847(5') was not expressed in flowers but in rosette leaves. It was more abundant in TMV-Cg-infected plants than in mock-infected plants (Fig. 4). This result reflected the tendency observed in the cloning frequency discussed earlier and northern blot results of other miRNAs reported previously.28
The predicted targets of these three miRNA candidates and miR847 are shown in Supplementary Table S1. However, we have not yet detected their possible cleaved fragment by the 5' RACE method.38
On the basis of the available data, we could not conclude which of small RNAs is a functional miRNA; miR847 and miR847(5') at present. Further analyses will be needed to make conclusion.
Recently, many results of comprehensive small RNA sequencing by 454 sequencing have been reported one after another in Arabidopsis.40
–43
It has been demonstrated that miRNAs are enriched in loss-of-function mutants of RNA-dependent RNA polymerase 2 (RDR2) and RNA polymerase IV because they are required for the majority of endogenous siRNAs.41
,43
By analyzing these mutant plants with the 454 sequencing method, dozens of miRNAs were discovered. In this study, we showed that plants infected with TMV-Cg are good materials for cloning and finding novel miRNAs frequently because cloning percentages of many miRNAs increase and newly identified miRNAs are found in virus-infected plants. Moreover, considering that the number of small RNA sequences read were tens to hundreds less than those of other groups, TMV-infected plants are very efficient materials to discover new miRNAs. It is anticipated that new miRNAs would be found from small RNAs in the virus-infected leaves if extensive reads were performed.
Most Arabidopsis miRNAs, expressed abundantly and conserved, have already been identified. However, there are many kinds of miRNAs which are less-expressed and non-conserved42
and it is possible that some are yet to be discovered. These miRNAs will be hereafter identified using plants under various conditions or mutant plants, which will leads to the identification of overall miRNAs and siRNAs and the understanding of how small RNAs are involved in many biological processes in Arabidopsis.
| Funding |
|---|
|
|
|---|
Sasakawa Scientific Research Grant from the Japan Science Society to Y.T.
| Supplementary Data |
|---|
|
|
|---|
Supplementary data are available online at www.dnaresearch.oxfordjournals.org.
| Acknowledgement |
|---|
|
|
|---|
We thank Dr Herve Vaucheret (INRA, France) for providing the dcl1-9 (BC6) and dcl4-1 (BC6) mutants.
| Footnotes |
|---|
* To whom correspondence should be addressed. Tel. +81-3-5454-6776. Fax. +81-3-5454-6776. E-mail: solan{at}bio.c.u-tokyo.ac.jp
| References |
|---|
|
|
|---|
- Vazquez F. Arabidopsis endogenous small RNAs: highways and byways. Trends Plant Sci. (2006) 11:460–468.[CrossRef][ISI][Medline]
- Vaucheret H. Post-transcriptional small RNA pathways in plants: mechanisms and regulations. Genes Dev. (2006) 20:759–771.
[Abstract/Free Full Text] - Jones-Rhoades M. W., Bartel D. P., Bartel B. MicroRNAS and their regulatory roles in plants. Annu. Rev. Plant Biol. (2006) 57:19–53.[CrossRef][Medline]
- Kurihara Y., Watanabe Y. Arabidopsis micro-RNA biogenesis through Dicer-like 1 protein functions. Proc. Natl. Acad. Sci. USA (2004) 101:12753–12758.
[Abstract/Free Full Text] - Kurihara Y., Takashi Y., Watanabe Y. The interaction between DCL1 and HYL1 is important for efficient and precise processing of pri-miRNA in plant microRNA biogenesis. RNA (2006) 12:206–212.
[Abstract/Free Full Text] - Han M. H., Goud S., Song L., Fedoroff N. The Arabidopsis double-stranded RNA-binding protein HYL1 plays a role in microRNA-mediated gene regulation. Proc. Natl. Acad. Sci. USA (2004) 101:1093–1098.
[Abstract/Free Full Text] - Yang L., Liu Z., Lu F., Dong A., Huang H. SERRATE is a novel nuclear regulator in primary microRNA processing in Arabidopsis. Plant J. (2006) 47:841–850.[CrossRef][ISI][Medline]
- Vazquez F., Gasciolli V., Crete P., Vaucheret H. The nuclear dsRNA binding protein HYL1 is required for microRNA accumulation and plant development, but not posttranscriptional transgene silencing. Curr. Biol. (2004) 14:346–351.[CrossRef][ISI][Medline]
- Fujioka Y., Utsumi M., Ohba Y., Watanabe Y. Location of a possible miRNA processing site in SmD3/SmB nuclear bodies in Arabidopsis. Plant Cell Physiol. (2007) 48:1243–1253.
[Abstract/Free Full Text] - Qi Y., Denli A. M., Hannon G. J. Biochemical specialization within Arabidopsis RNA silencing pathways. Mol. Cell (2005) 19:421–428.[CrossRef][ISI][Medline]
- Baumberger N., Baulcombe D. C. Arabidopsis ARGONAUTE1 is an RNA Slicer that selectively recruits microRNAs and short interfering RNAs. Proc. Natl. Acad. Sci. USA (2005) 102:11928–11933.
[Abstract/Free Full Text] - Adenot X., Elmayan T., Lauressergues D., et al. DRB4-dependent TAS3 trans-acting siRNAs control leaf morphology through AGO7. Curr. Biol. (2006) 16:927–932.[CrossRef][ISI][Medline]
- Nakazawa Y., Hiraguri A., Moriyama H., Fukuhara T. The dsRNA-binding protein DRB4 interacts with the Dicer-like protein DCL4 in vivo and functions in the trans-acting siRNA pathway. Plant Mol. Biol. (2007) 63:777–785.[CrossRef][ISI][Medline]
- Vaucheret H. MicroRNA-dependent trans-acting siRNA production. Sci. STKE (2005) 2005:ppe43.
- Borsani O., Zhu J., Verslues P. E., Sunkar R., Zhu J. K. Endogenous siRNAs derived from a pair of natural cis-antisense transcripts regulate salt tolerance in Arabidopsis. Cell (2005) 123:1279–1291.[CrossRef][ISI][Medline]
- Katiyar-Agarwal S., Morgan R., Dahlbeck D., et al. A pathogen-inducible endogenous siRNA in plant immunity. Proc. Natl. Acad. Sci. USA (2006) 103:18002–18007.
[Abstract/Free Full Text] - Molnar A., Csorba T., Lakatos L., Varallyay E., Lacomme C., Burgyan J. Plant virus-derived small interfering RNAs originate predominantly from highly structured single-stranded viral RNAs. J. Virol. (2005) 79:7812–7818.
[Abstract/Free Full Text] - Deleris A., Gallego-Bartolome J., Bao J., Kasschau K. D., Carrington J. C., Voinnet O. Hierarchical action and inhibition of plant Dicer-like proteins in antiviral defense. Science (2006) 313:68–71.
[Abstract/Free Full Text] - Akbergenov R., Si-Ammour A., Blevins T., et al. Molecular characterization of geminivirus-derived small RNAs in different plant species. Nucleic Acids Res. (2006) 34:462–471.
[Abstract/Free Full Text] - Moissiard G., Voinnet O. RNA silencing of host transcripts by cauliflower mosaic virus requires coordinated action of the four Arabidopsis Dicer-like proteins. Proc. Natl. Acad. Sci. USA (2006) 103:19593–19598.
[Abstract/Free Full Text] - Bouche N., Lauressergues D., Gasciolli V., Vaucheret H. An antagonistic function for Arabidopsis DCL2 in development and a new function for DCL4 in generating viral siRNAs. EMBO J. (2006) 25:3347–3356.[CrossRef][ISI][Medline]
- Wang M. B., Metzlaff M. RNA silencing and antiviral defense in plants. Curr. Opin. Plant Biol. (2005) 8:216–222.[CrossRef][ISI][Medline]
- Li W. X., Ding S. W. Viral suppressors of RNA silencing. Curr. Opin. Biotechnol. (2001) 12:150–154.[CrossRef][ISI][Medline]
- Ye K., Malinina L., Patel D. J. Recognition of small interfering RNA by a viral suppressor of RNA silencing. Nature (2003) 426:874–878.[CrossRef][Medline]
- Lakatos L., Csorba T., Pantaleo V., et al. Small RNA binding is a common strategy to suppress RNA silencing by several viral suppressors. EMBO J. (2006) 25:2768–2780.[CrossRef][Medline]
- Zhang X., Yuan Y. R., Pei Y., et al. Cucumber mosaic virus-encoded 2b suppressor inhibits Arabidopsis Argonaute1 cleavage activity to counter plant defense. Genes Dev. (2006) 20:3255–3268.
[Abstract/Free Full Text] - Kurihara Y., Watanabe Y. A TMV-Cg mutant with a truncated coat protein induces cell death resembling the hypersensitive response in Arabidopsis. Mol. Cells (2004) 17:334–339.[ISI][Medline]
- Kurihara Y., Inaba N., Kutsuna N., Takeda A., Tagami Y., Watanabe Y. The binding of tobamovirus replication protein with small RNA duplexes. J. Gen. Virol (2007) in press.
- Ding X. S., Liu J., Cheng N. H., et al. The Tobacco mosaic virus 126-kDa protein associated with virus replication and movement suppresses RNA silencing. Mol. Plant Microbe. Interact. (2004) 17:583–592.[ISI][Medline]
- Kubota K., Tsuda S., Tamai A., Meshi T. Tomato mosaic virus replication protein suppresses virus-targeted posttranscriptional gene silencing. J. Virol. (2003) 77:11016–11026.
[Abstract/Free Full Text] - Yu B., Chapman E. J., Yang Z., Carrington J. C., Chen X. Transgenically expressed viral RNA silencing suppressors interfere with microRNA methylation in Arabidopsis. FEBS Lett. (2006) 580:3117–3120.[CrossRef][ISI][Medline]
- Zuker M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. (2003) 31:3406–3415.
[Abstract/Free Full Text] - Zhang Y. miRU: an automated plant miRNA target prediction server. Nucleic Acids Res. (2005) 33:W701–W704.
[Abstract/Free Full Text] - Nakano M., Nobuta K., Vemaraju K., Tej S. S., Skogen J. W., Meyers B. C. Plant MPSS databases: signature-based transcriptional resources for analyses of mRNA and small RNA. Nucleic Acids Res. (2006) 34:D731–D735.
[Abstract/Free Full Text] - Gustafson A. M., Allen E., Givan S., Smith D., Carrington J. C., Kasschau K. D. ASRP: the Arabidopsis Small RNA Project Database. Nucleic Acids Res. (2005) 33:D637–D640.
[Abstract/Free Full Text] - Xie Z., Allen E., Wilken A., Carrington J. C. DICER-LIKE 4 functions in trans-acting small interfering RNA biogenesis and vegetative phase change in Arabidopsis thaliana. Proc. Natl. Acad. Sci. USA (2005) 102:12984–12989.
[Abstract/Free Full Text] - Mallory A. C., Reinhart B. J., Bartel D., Vance V. B., Bowman L. H. A viral suppressor of RNA silencing differentially regulates the accumulation of short interfering RNAs and micro-RNAs in tobacco. Proc. Natl. Acad. Sci. USA (2002) 99:15228–15233.
[Abstract/Free Full Text] - Kasschau K. D., Xie Z., Allen E., et al. P1/HC-Pro, a viral suppressor of RNA silencing, interferes with Arabidopsis development and miRNA unction. Dev. Cell (2003) 4:205–217.[CrossRef][ISI][Medline]
- Blevins T., Rajeswaran R., Shivaprasad P. V., et al. Four plant Dicers mediate viral small RNA biogenesis and DNA virus induced silencing. Nucleic Acids Res. (2006) 34:6233–6246.
[Abstract/Free Full Text] - Rajagopalan R., Vaucheret H., Trejo J., Bartel D. P. A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana. Genes Dev. (2006) 20:3407–3425.
[Abstract/Free Full Text] - Zhang X., Henderson I. R., Lu C., Green P. J., Jacobsen S. E. Role of RNA polymerase IV in plant small RNA metabolism. Proc. Natl. Acad. Sci. USA (2007) 104:4536–4541.
[Abstract/Free Full Text] - Fahlgren N., Howell M. D., Kasschau K. D., et al. High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of miRNA genes. PLoS ONE (2007) 2.
- Lu C., Kulkarni K., Souret F. F., et al. MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant. Genome Res. (2006) 16:1276–1288.
[Abstract/Free Full Text]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



