Skip Navigation

DNA Research 2005 12(3):181-189; doi:10.1093/dnares/dsi001
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (3)
Right arrow Request Permissions
Google Scholar
Right arrow Articles by Okazaki, N.
Right arrow Articles by Koga, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Okazaki, N.
Right arrow Articles by Koga, H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2005. Kazusa DNA Research Institute

Influence of the 3'-UTR-length of mKIAA cDNAs and their Sequence Features to the mRNA Expression Level in the Brain

Noriko Okazaki1,*, Kazuhide Imai2, Reiko F. Kikuno1, Kazuharu Misawa2, Makoto Kawai2, Susumu Inamoto2,3, Reiko Ohara1, Takahiro Nagase1, Osamu Ohara1,4 and Hisashi Koga1,2

1Kazusa DNA Research Institute 2-6-7 Kazusa-Kamatari, Kisarazu, Chiba 292-0818
2Chiba Industry Advancement Center 2-6 Nakase, Mihama-ku, Chiba 261-7126
3Institute of Research and Innovation 1201 Takada, Kashiwa, Chiba 277-0861
4RIKEN Yokohama Institute 1-7-22 Suehiro-cho, Tsurumi-ku, Yokohama City, Kanagawa, 230-0045, Japan

Received 24 January 2005; revised 4 April 2005


    Abstract
 Top
 Abstract
 1. Introduction
 2. Materials and Methods
 3. Results
 4. Discussion
 Acknowledgements
 References
 
We have previously described the sequence features of ~1500 mouse KIAA (mKIAA) genes in comparison with those of human KIAA genes (Okazaki, N., Kikuno, R., Inamoto, S., Hara, Y., Nagase, T., Ohara, O., and Koga, H. 2002, DNA Res., 9, 179–188; Okazaki, N., Kikuno, R., Ohara, R., Inamoto, S., Aizawa, H., Yuasa, S., Nakajima, D., Nagase, T., Ohara, O., and Koga, H. 2003, DNA Res., 10, 35–48; Okazaki, N., Kikuno, R., Ohara, R., Inamoto, S., Koseki, H., Hiraoka, S., Saga, Y., Nagase, T., Ohara, O., and Koga, H. 2003, DNA Res., 10, 167–180; and Okazaki, N., F-Kikuno, R., Ohara, R., Inamoto, S., Koseki, H., Hiraoka, S., Saga, Y., Seino, S., Nishimura, M., Kaisho, T., Hoshino, K., Kitamura, H., Nagase, T., Ohara, O., and Koga, H. 2004, DNA Res., 11, 205–218). To validate the orthologous relationship between mKIAA and KIAA genes in detail, we examined their chromosomal positions and evolutionary rate of synonymous substitutions and confirmed that >93% of the mKIAA/KIAA gene pairs are orthologous. During the sequence analysis of mKIAA genes, we found that 3'-untranslated region (3'-UTR) lengths of mKIAA and KIAA genes are extremely long. In the meanwhile, we have also examined the tissue-specific expression of ~1700 mKIAA genes using cDNA microarray and verified predominantly their expression in adult brain (Koga, H., Yuasa, S., Nagase, T., Shimada, K., Nagano, M., Imai, K., Ohara, R., Nakajima, D., Murakami, M., Kawai, M., Miki, F., Magae, J., Inamoto, S., Okazaki, N., Ohara, O. 2004, DNA Res., 11, 293–304). To connect these two evidences, we statistically analysed the relationship between them by using the mKIAA genes. Consequently, a positive correlation was observed between the 3'-UTR lengths and the relative expression intensities in adult brain. Furthermore, we searched sequence elements in the 3'-UTR possibly related with their expression and found some candidates regarding the brain-specific expression.

Key words: mKIAA; orthology; 3'-UTR; expression; brain


    1. Introduction
 Top
 Abstract
 1. Introduction
 2. Materials and Methods
 3. Results
 4. Discussion
 Acknowledgements
 References
 
After completion of the human genome project, numerous genes have been predicted by bioinformatic approachs. However, library construction still serves as a critical resource of actually existing genes and a platform for comprehensive analysis of the gene functions. With this in mind, we have constructed several cDNA libraries and initiated a human cDNA project to accumulate information regarding the long protein coding sequences (CDSs) of unidentified human genes since 1994.1Go We have isolated and entirely sequenced long human cDNA clones (>4 kb) and have already registered >2000 genes (KIAA genes) to the public database to date. However, the function has been identified in some genes, half of the genes are still remained to be elucidated mainly depending on their difficulty for using human materials. Therefore, we decided to collect mouse KIAA cDNAs (mKIAA) for further functional analysis in a model organism.

We have previously reported the sequences of ~1500 mKIAA cDNAs and the tissue-specific expression of ~1700 mKIAA genes using cDNA microarray.2Go–6Go The entire sequence of mKIAA cDNAs revealed that mKIAA (also KIAA) cDNAs have extremely long 3'-untranslated region (3'-UTR) sequences. Furthermore, cDNA microarray analysis elucidated that ~30% of the genes are predominantly expressed in the brain. We thus assumed some correlations lie between the two observations. The 3'-UTR sequences are critical for determining mRNA stability, mRNA targeting and level of translation.7Go–13Go The sequences are also known to be important for the pathogenesis of some disease through regulation of mRNA stability.14Go Although molecular neuroscientists have empirically noted that mRNAs abundant in the brain have long 3'-UTR, statistical or comprehensive approaches on the correlation between the expression levels and the 3'-UTR lengths have not been performed.

In this paper, we first validate the orthology of mKIAA and KIAA cDNA pairs; subsequently, we report the statistical correlation between the relative expression levels in the brain and the 3'-UTR lengths, and discuss the possible functional sequence elements in the 3'-UTRs found in mKIAA and KIAA cDNAs.


    2. Materials and Methods
 Top
 Abstract
 1. Introduction
 2. Materials and Methods
 3. Results
 4. Discussion
 Acknowledgements
 References
 
2.1. Nucleotide sequences
We obtained mKIAA and KIAA cDNA sequences from our ROUGE (http://www.kazusa.or.jp/rouge/index.html) and HUGE (http://www.kazusa.or.jp/huge/index.html) databases, respectively.

2.2. Estimation of orthology
We estimated the evolutionary relationship between KIAA and mKIAA by the following steps: (i) find chromosomal position of KIAA genes using the NCBI Map Viewer (http://www.ncbi.nlm.nih.gov/mapview/map_search.cgi/);15Go (ii) find the mouse chromosomal region corresponding to the human chromosomal region encoding the KIAA genes using the NCBI Map Viewer; (iii) find the chromosomal position of mKIAA using BLAST search;16Go and (iv) compare the mouse chromosomal region found in (ii) with the chromosomal position of mKIAA gene found in (iii). The number of synonymous substitutions per site (dS) was estimated by Nei and Gojobori's method17Go using SNAP program.18Go,19Go

2.3. A search for candidate elements effecting on the specific expression in brain
We extracted conserved 3'-UTR sequences between 50 mKIAA highly expressing in brain and their orthologous KIAA cDNAs. The MEME program (http://meme.sdsc.edu/meme/website/meme.html) was used to find 20–25 bp elements that appeared >50 times. The existence of newly identified sequence elements was searched with >60% nucleotide identity against the 3'-UTR sequences of 1031 mKIAA cDNAs, which were verified for the integrity of the 3'-UTR structure. The existence of the elements was also searched against 3'-UTRs of non-mKIAA genes in UTRdb (http://www.ba.itb.cnr.it/BIG/UTRHome/) entries using BLAST search. Differences of the relative expression levels in brain between mKIAA cDNAs with and without the elements were calculated by the Student's t-test. The tissue specific expression of each gene was based on the descriptions in the literature or our original data (freely available through our database).6Go


    3. Results
 Top
 Abstract
 1. Introduction
 2. Materials and Methods
 3. Results
 4. Discussion
 Acknowledgements
 References
 
3.1. Identification of mouse KIAA-homologous cDNAs
The mouse homologs of KIAA genes were isolated from size-fractionated cDNA libraries (Table 1). Approximately 55% of KIAA cDNAs (1116 out of 2038 cDNAs) were derived from adult human brain libraries; thus, we initially subjected 23 000 end sequences of adult mouse brain library for the screening of mKIAA genes and identified nearly half of mKIAA cDNAs. The remainder was isolated from other libraries and consequently 1499 mKIAA homologs were successfully isolated and entirely sequenced. By comparing the mKIAA cDNA sequences with human sequences, we designated those 1479 mouse cDNA clones as ‘mKIAA’ and the same four-digit number corresponding to human clones. Although 20 cDNA clones were eventually found not to be orthologous to any KIAA cDNAs, these cDNAs were conventionally designated as ‘mKIAA and a four-digit number that has not been allocated for human KIAA genes (mKIAA3000s). The average length of the cDNA inserts was 4.6 kb and deduced gene products was 830 amino acid residues. Multiple CDSs were found in 237 mKIAA cDNAs that are longer than 50 amino acid residues and have high amino acid identity (>50%) to corresponding KIAA by FASTA analysis.20Go These multiple CDSs are thought to be produced by spurious CDS splits caused by retained intron(s), alternative splicing or splicing error, reverse transcription error(s) or other cloning artifacts.2Go–5Go We evaluated the spurious CDS splits through the sequence comparison of mouse and human KIAA cDNA pairs and the genome/cDNA structures,2Go–5Go and we found that 144 mKIAA cDNA clones appeared to retain intron(s). Taking the assumption into consideration, alternative prediction of the deduced gene products might increase to 873 amino acid residues.


View this table:
[in this window]
[in a new window]
 
Table 1. The details of cDNA libraries used in this study.

 
3.2. Orthology between mouse and human KIAAs
We have only defined the cDNA sequences as mouse homologs of KIAA genes when they showed the highest homology against the corresponding human KIAA genes at the time of being sequenced. To support orthologous relationship of mKIAA and KIAA gene pairs, we assigned their chromosomal positions and examined whether they were derived from the common ancestral chromosomal location. We classified the positional relations of the gene pairs into the following three categories using the NCBI Map Viewer:21Go (i) the 896 gene pairs located on the corresponding chromosomal regions between mouse and human; they would be judged to be orthologous; (ii) the 102 gene pairs not located on the corresponding chromosomal regions; they could not be judged to be orthologous; and (iii) the 481 gene pairs whose sequence or data on the chromosome location were not available; also, they could not be judged to be orthologous.

For further verification of the orthology, we also investigated the evolutionary rate of dS estimated by the Nei and Gojobori's method.17Go The rate of human/mouse orthologous pair is approximately constant, since they are diverged concurrently 80 million years ago and accumulated dS during the same period.22Go Paralogous gene pairs usually show higher rate of dS than orthologous gene pairs.23Go The dS of 1479 mKIAA/KIAA pairs (0.64 ± 0.22, max. = 4.86, min. = 0.01) is slightly higher but consistent with the previous study that calculated dS of orthologous gene pairs between human and mouse (0.55 ± 0.63).23Go Therefore, most of the mKIAA/KIAA pairs were thought to be orthologous. We then compared the distribution of the dS values among the above-mentioned three categories based on the chromosomal positions (Fig. 1a). The distributions of dS values were quite similar, therefore, not many paralogs would be included if they exist in the gene pairs whose correspondence was not supported by the chromosomal locations. Furthermore, to confirm the orthology we examined in detail the orthology of the 100 gene pairs that showed unusually high rate of dS (> mean + 1.31 SD) by the phylogenetic analysis (Table 2, Fig. 1b).24Go Among them 93 mKIAA genes were confirmed to be orthologs, whereas the remaining seven mKIAA genes (mKIAA0345, mKIAA0420, mKIAA0588, mKIAA1032, mKIAA1074, mKIAA1120 and mKIAA1811) were determined to be paralogs of the corresponding KIAA genes. These results suggest that most of the KIAA/mKIAA gene pairs have orthologous relationship, and if the paralogous pairs existed it must be <7%.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 1. Histogram of dS and phylogenetic tree for mKIAA/KIAA possible orthologous pairs. (a) Histograms of dS of gene pairs classified into the following three categories by chromosomal localization: (1) the gene pairs located on the corresponding chromosomal regions between human and mouse calculated by Map Viewer; these regions are considered to be derived from the common regions of the ancestral chromosome; (2) the gene pairs whose chromosomal locations were not corresponding to each other; and (3) the gene pairs whose data on the chromosome location or sequence were not available. (b) A representative phylogenetic tree of mKIAA/KIAA protein and 10 highly homologous proteins based on amino acid content. Phylogenetic trees were constructed and analysed by neighbor-joining method.24Go The numbers above the branches are confidence values based on Felsenstein's bootstrap method.37Go When mKIAA protein belongs to the closest mouse group to KIAA protein, mKIAA protein was estimated to be the ortholog. In this case, mKIAA1032 is defined as the ortholog of NP 006368/AAC19406.

 

View this table:
[in this window]
[in a new window]
 
Table 2. Orthology between mouse and human KIAAs.

 
3.3. Sequence comparison of mouse and human KIAA cDNA pairs
In our previous study, we reported the sequence identity of 3'-UTR and CDSs for the 100 mouse and human KIAA cDNA pairs.2Go We extended the same analysis to the 1468 gene pairs (Table 3). Similar to our previous study, the average aligned length of CDS and 3'-UTR of mKIAA and KIAA cDNAs are 2–3 times longer than reported by the other group, while the observed sequence identities of KIAA and mKIAA cDNAs in CDS and 3'-UTR agreed with the values by the other group.23Go In Saccharomyces cerevisiae, the UTR lengths are in a narrow range whereas the CDS lengths widely change in parallel with the mRNA lengths.25Go Although this narrow range of the UTR lengths is applicable to other species, the considerably long 3'-UTR sequences of mKIAA/KIAA cDNAs would be exceptional. Thus, the longer length and high conservation of 3'-UTR sequences of mKIAA/KIAA cDNAs may imply the unverified important roles in the sequences.


View this table:
[in this window]
[in a new window]
 
Table 3. Sequence identities of CDS and 3'-UTR between mKIAA/KIAA cDNA pairs.

 
3.4. Positive correlation between the brain-specific expression and the 3'-UTR length of the genes
Previously, we examined tissue-specific expression of mKIAA genes using mKIAA cDNA microarray.6Go On the microarray, 1467 out of 1499 mKIAA cDNAs were spotted in this study and ~30% of the genes were predominantly expressed in the brain. Therefore, we focused on the long 3'-UTRs to examine the relationship between brain-specific expression and their sequence features. Statistical analysis of ~1031 clones using the Kendall rank correlation measurement revealed a significant correlation between 3'-UTR lengths and relative expression levels in the brain, exhibiting correlation coefficient (Tau) = 0.16, P = 1.7 × 10–14. However, there were no significant correlation between relative expression levels in other tissues and their 3'-UTR lengths (Table 4). To exclude the bias against the sources of cDNA libraries, the clones were subdivided into two groups (brain-derived and other tissues-derived) and statistically analysed using the same formula. Again, we observed significant correlation between 3'-UTR lengths and relative expression levels in both groups [brain, (Tau) = 0.14, P = 7.3 × 10–6, other tissues, (Tau) = 0.13, P = 1.3 × 10–5]. Furthermore, we examined the relationship between CDS or 5'-UTR lengths and relative expression levels in the brain but could not observe any significant correlation (Table 5). The lower correlation coefficient in these datasets was supposed to occur by a limited number of samples.


View this table:
[in this window]
[in a new window]
 
Table 4. Statistical analysis of the relationship between tissue-specific expression and 3'-UTR length of the mKIAA cDNA clones.

 

View this table:
[in this window]
[in a new window]
 
Table 5. The relative level of expression in brain was positively correlated with the length of 3'-UTR but not the length of CDS.

 
3.5. Candidates for the cDNA elements effecting on the brain-specific expression of the genes
To find the novel sequence elements in the 3'-UTRs associating with the high-level expression in brain, we searched highly conserved sequence elements between mKIAA ranked within 50 places and their orthologous KIAA cDNAs using MEME program (http://meme.sdsc.edu/meme/website/). We calculated the differences of the relative expression levels in brain between mKIAA with and without the elements, and selected 43 statistically significant (P < 10–3) elements among 66 elements that were extracted by MEME program (Table 6). We then searched the elements against 3'-UTRs of non-mKIAA genes in UTRdb entries. Consequently, we identified seven elements at the 3'-UTRs in 18 non-mKIAA genes and the elements were conserved among several species (mouse, human, rat, rabbit and bovine). Although there is little information about their expression, the predominant expression in the brain of vms-tm2 gene containing an element (TCTTTTGTTTTAAAAGAAGAAATAT) could be found in the previous report. This result was consistent with our result; further accumulation of expression data is necessary for statistical verification of functional significance of the elements.


View this table:
[in this window]
[in a new window]
 
Table 6. Sequence elements found in the 3'-UTR mKIAA/KIAA gene pairs showing relatively high expression in the brain.

 

    4. Discussion
 Top
 Abstract
 1. Introduction
 2. Materials and Methods
 3. Results
 4. Discussion
 Acknowledgements
 References
 
To discover novel functional aspect of UTRs, we prepared 1479 mKIAA/KIAA cDNA pairs and verified the orthology from their chromosomal location and the evolutionary rate of dS. Using these mouse cDNAs, we identified a positive correlation between the 3'-UTR length and the relative expression levels in the brain. Paying attention to the function of each gene, for instance, it appears that genes involved in G-protein signaling and vesicle trafficking dominantly expressing in the brain tended to have long 3'-UTR (data not shown). It was already assumed that 3'-UTR length increases with evolutionary age and organism complexity.26Go Moreover, molecular neuroscientists have empirically noted that mRNAs, the most abundant in the brain, have long 3'-UTR. Therefore, it seems reasonable to propose that the genes predominantly expressed in mammalian brain have evolved to have long 3'-UTR. Growing evidences of RNA-binding proteins also demonstrates the importance of various 3'-UTR elements in regulation of mRNA turnover at the posttranscriptional level.27Go These evidences and our result motivated us to find novel sequence elements in the 3'-UTR.

MEME is a web-based tool for discovering elements in a group of related DNA sequences, thus we applied this program to find the highly conserved sequence elements in mKIAA/KIAA cDNAs revealed relatively high expression in the brain. We found 43 statistically significant elements in mKIAA/KIAA cDNAs and identified 7 out of 43 elements in the 3'-UTRs of 18 non-mKIAA genes in UTRdb. Among the several elements in 3'-UTRs that regulate the mRNA levels posttranscriptionally, the novel elements in this study might be one of such kind of elements. Biochemical approaches as well as accumulation of the expression profile of non-mKIAA genes containing the elements may help the verification of the novel elements on the predominant expression in brain. Among those elements, adenylate uridylate-rich elements (AU-rich elements, AREs) are the best characterized elements in 3'-UTR, and posttranscriptionally regulate the cytoplasmic half-life of the mRNAs encoding various proteins that regulate cellular proliferation/differentiation and response to inflammatory and environmental stimuli.28Go Cytidine-rich 15-lipoxygenase differentiation control element (15-LOX DICE) is another well-characterized element in 3'-UTR and is a multifunctional cis-element found in numerous eukaryotic mRNAs.29Go Although there were many AREs and 15-LOX DICEs in mKIAA cDNAs, the numbers of the elements simply correlated with the 3'-UTR length but not obviously with the relative expression level in the brain (data not shown).

The elements involved in tissue, stage or cell-type specific expression of the genes had also been reported; however, the specific expression of the genes is partly due to the specific expression of certain RNA-binding proteins. For example, mRNA of membrane-bound IL-1R accessory protein expressing in a tissue-specific manner has several elements in the 3'-UTR and the stability is thought to be parallel to the expression of some RNA-binding protein.30Go Neurofilament-M (NF-M) expression is stage-specific and culminates at the most mature stages of axon development. This alteration is partly regulated by the NF-M mRNA stability, parallel with the binding of hnRNP to NF-M 3'-UTRs.31Go Especially in the brain, several RNA-binding proteins expressing in neuronal cell-type or stage-specific manner have been already identified; for instance, three ELAV-like proteins (HuB, HuC and HuD),32Go Musashi,33Go Autoimmune antigens Nova,34Go polypyrimidine tract-binding protein-like protein35Go and Drb1.36Go In the brain, posttranscriptional regulation might be more popular than any other organ and multiple RNA-binding proteins might act through the long 3'-UTR of target genes and control them in a complex manner. Since numerous RNA-binding proteins have been reported in particularly matured neuron in which the proteins might play important roles in terminal neuronal differentiation, perpetual neurite outgrowth/retraction and synaptogenesis. Since the long 3'-UTR of mKIAA/KIAA mRNAs potentially have multiple functional elements, the mRNA levels might be regulated by the combination of multiple brain-specific RNA-binding proteins. Accumulating information about sequence elements in mRNA, neuron-specific RNA-binding proteins and their interactions is promising to solve these complicated regulations.


    Acknowledgements
 Top
 Abstract
 1. Introduction
 2. Materials and Methods
 3. Results
 4. Discussion
 Acknowledgements
 References
 
We thank Nobue Kashima for her technical assistance. This project was supported by grants from the Kazusa DNA Research Institute. This study was also supported by the CREATE Program (Collaboration of Regional Entities for the Advancement of Technological Excellent) from JST (Japan Science and Technology Corporation).


    Footnotes
 
*To whom correspondence should be addressed. Tel. +81-438-52-3932, Fax. +81-438-52-3931, E-mail: nokazaki{at}kazusa.or.jp

Communicated by Michio Oishi


    References
 Top
 Abstract
 1. Introduction
 2. Materials and Methods
 3. Results
 4. Discussion
 Acknowledgements
 References
 

  1. Nomura, N., Miyajima, N., Sazuka, T., et al. 1994, Prediction of the coding sequences of unidentified human genes. I. The coding sequences of 40 new genes (KIAA0001-KIAA0040) deduced by analysis of randomly sampled cDNA clones from human immature myeloid cell line KG-1, DNA Res., 1, 27–35.[Abstract/Free Full Text]
  2. Okazaki, N., Kikuno, R., Ohara, R., et al. 2002, Prediction of the coding sequences of mouse homologues of KIAA gene: I. The complete nucleotide sequences of 100 mouse KIAA-homologous cDNAs identified by screening of terminal sequences of cDNA clones randomly sampled from size-fractionated libraries, DNA Res., 9, 179–188.[Abstract]
  3. Okazaki, N., Kikuno, R., Ohara, R., et al. 2003, Prediction of the coding sequences of mouse homologues of KIAA gene: II. The complete nucleotide sequences of 400 mouse KIAA-homologous cDNAs identified by screening of terminal sequences of cDNA clones randomly sampled from size-fractionated libraries, DNA Res., 10, 35–48.[Abstract]
  4. Okazaki, N., Kikuno, R., Ohara, R., et al. 2003, Prediction of the coding sequences of mouse homologues of KIAA gene: III. the complete nucleotide sequences of 500 mouse KIAA-homologous cDNAs identified by screening of terminal sequences of cDNA clones randomly sampled from size-fractionated libraries, DNA Res., 10, 167–180.[Abstract]
  5. Okazaki, N., F-Kikuno, R., Ohara, R., et al. 2004, Prediction of the coding sequences of mouse homologues of KIAA gene: IV. The complete nucleotide sequences of 500 mouse KIAA-homologous cDNAs identified by screening of terminal sequences of cDNA clones randomly sampled from size-fractionated libraries, DNA Res., 11, 205–218.[Abstract]
  6. Koga, H., Yuasa, S., Nagase, T., et al. 2004, A comprehensive approach for establishment of the platform to analyze functions of KIAA proteins II: public release of inaugural version of InGaP database containing gene/protein expression profiles for 127 mouse KIAA genes/proteins, DNA Res., 11, 293–304.[Abstract]
  7. Jackson, R. J. 1993, Cytoplasmic regulation of mRNA function: the importance of the 3' untranslated region, Cell, 74, 9–14.[CrossRef][Web of Science][Medline]
  8. Curtis, D., Lehmann, R., Zamore, P. D. 1995, Translational regulation in development, Cell, 81, 171–178.[CrossRef][Web of Science][Medline]
  9. Hentze, M. W. 1995, Translational regulation: versatile mechanisms for metabolic and developmental control, Curr. Opin. Cell Biol., 7, 393–398.[CrossRef][Web of Science][Medline]
  10. Wickens, M., Anderson, P., Jackson, R. J. 1997, Life and death in the cytoplasm: messages from the 3' end, Curr. Opin. Genet. Dev., 7, 220–232.[CrossRef][Web of Science][Medline]
  11. Siomi, H. and Dreyfuss, G. 1997, RNA-binding proteins as regulators of gene expression, Curr. Opin. Genet. Dev., 7, 345–353.[CrossRef][Web of Science][Medline]
  12. Day, D. A. and Tuite, M. F. 1998, Post-transcriptional gene regulatory mechanisms in eukaryotes: an overview, J. Endocrinol., 157, 361–371.[Abstract]
  13. Derrigo, M., Cestelli, A., Savettieri, G., Di Liegro, I. 2000, RNA-protein interactions in the control of stability and localization of messenger RNA (review), Int. J. Mol. Med., 5, 111–123.[Web of Science][Medline]
  14. Lindquist, J. N., Parsons, C. J., Stefanovic, B., Brenner, D. A. 2004, Regulation of alpha1(I) collagen messenger RNA decay by interactions with alphaCP at the 3'-untranslated region, J. Biol. Chem., 279, 23822–23829.[Abstract/Free Full Text]
  15. Dombrowski, S. M. and Maglott, D. 2002, Using the Map Viewer to explore genomes, The NCBI Handbook [Internet]. National Library of Medicine (US), National Center for Biotechnology Information, Bethesda (MD).
  16. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. 1990, Basic local alignment search tool, J. Mol. Biol., 215, 403–410.[CrossRef][Web of Science][Medline]
  17. Nei, M. and Gojobori, T. 1986, Simple methods for estimating the numbers of synonymous and nonsynonymous nucleotide substitutions, Mol. Biol. Evol., 3, 418–426.[Abstract]
  18. Ganeshan, S., Dickover, R. E., Korber, B. T., Bryson, Y. J., Wolinsky, S. M. 1997, Human immunodeficiency virus type 1 genetic evolution in children with different rates of development of disease, J. Virol., 71, 663–677.[Abstract]
  19. Korber, B. 2000, HIV signature and sequence variation analysis, Dordrecht, The Netherlands Computational Analysis of HIV Molecular Sequences, Ch. 4. Kluwer Academic Publishers55–72.
  20. Brenner, S. E., Chothia, C., Hubbard, T. J. 1998, Assessing sequence comparison methods with reliable structurally identified distant evolutionary relationships, Proc. Natl Acad. Sci. U.S.A., 95, 6073–6078.[Abstract/Free Full Text]
  21. Wheeler, D. L., Church, D. M., Federhen, S., et al. 2003, Database resources of the National Center for Biotechnology, Nucleic Acids Res., 31, 28–33.[Abstract/Free Full Text]
  22. Kumar, S. and Hedges, S. B. 1998, A molecular timescale for vertebrate evolution, Nature, 392, 917–920.
  23. Makalowski, W. and Boguski, M. S. 1998, Evolutionary parameters of the transcribed mammalian genome: an analysis of 2820 orthologous rodent and human sequences, Proc. Natl. Acad. Sci. U.S.A., 95, 9407–9412.[Abstract/Free Full Text]
  24. Saitou, N. and Nei, M. 1987, The neighbor-joining method: a new method for reconstructing phylogenetic trees, Mol. Biol. Evol., 4, 406–425.[Abstract]
  25. Hurowitz, E. H. and Brown, P. O. 2003, Genome-wide analysis of mRNA lengths in Saccharomyces cerevisiae, Genome Biol., 5, R2.[CrossRef][Medline]
  26. Mazumder, B., Seshadri, V., Fox, P. L. 2003, Translational control by the 3'-UTR: the ends specify the means, Trends Biochem. Sci., 28, 91–98.[CrossRef][Web of Science][Medline]
  27. Grzybowska, E. A., Wilczynska, A., Siedlecki, J. A. 2001, Regulatory functions of 3'UTRs, Biochem. Biophys. Res. Commun., 288, 291–295.[CrossRef][Web of Science][Medline]
  28. Bakheet, T., Frevel, M., Williams, B. R., Greer, W., Khabar, K. S. 2001, ARED: human AU-rich element-containing mRNA database reveals an unexpectedly diverse functional repertoire of encoded proteins, Nucleic Acids Res., 29, 246–254.[Abstract/Free Full Text]
  29. Reimann, I., Huth, A., Thiele, H., Thiele, B. J. 2002, Suppression of 15-lipoxygenase synthesis by hnRNP E1 is dependent on repetitive nature of LOX mRNA 3'-UTR control element DICE, J. Mol. Biol., 315, 965–974.[CrossRef][Web of Science][Medline]
  30. Jensen, L. E. and Whitehead, A. S. 2004, The 3' untranslated region of the membrane-bound IL-1R accessory protein mRNA confers tissue-specific destabilization, J. Immunol., 173, 6248–6258.[Abstract/Free Full Text]
  31. Thyagarajan, A. and Szaro, B. G. 2004, Phylogenetically conserved binding of specific KH domain proteins to the 3' untranslated region of the vertebrate middle neurofilament mRNA, J. Biol. Chem., 279, 49680–49688.[Abstract/Free Full Text]
  32. Good, P. J. 1995, A conserved family of elav-like genes in vertebrates, Proc. Natl. Acad. Sci. U.S.A., 92, 4557–4561.[Abstract/Free Full Text]
  33. Okano, H., Imai, T., Okabe, M. 2002, Musashi: a translational regulator of cell fate, J. Cell Sci., 115, 1355–1359.[Abstract/Free Full Text]
  34. Musunuru, K. 2003, Cell-specific RNA-binding proteins in human disease, Trends Cardiovasc. Med., 13, 188–195.[CrossRef][Web of Science][Medline]
  35. Kikuchi, T., Ichikawa, M., Arai, J., et al. 2000, Molecular cloning and characterization of a new neuron-specific homologue of rat polypyrimidine tract binding protein, J. Biochem. (Tokyo), 128, 811–821.[Abstract/Free Full Text]
  36. Tamada, H., Sakashita, E., Shimazaki, K., et al. 2002, cDNA cloning and characterization of Drb1, a new member of RRM-type neural RNA-binding protein, Biochem. Biophys. Res. Commun., 297, 96–104.[CrossRef][Web of Science][Medline]
  37. Borodovsky, M., McIninch, J. D., Koonin, E. V., Rudd, K. E., Medigue, C., Danchin, A. 1995, Detection of new genes in a bacterial genome using Markov models for three gene classes, Nucleic Acids Res., 23, 3554–3562.[Abstract/Free Full Text]
  38. Sapru, M. K., Gao, J. P., Walke, W., Burmeister, M., Goldman, D. 1996, Cloning and characterization of a novel transcriptional repressor of the nicotinic acetylcholine receptor delta-subunit gene, J. Biol. Chem., 271, 7203–7211.[Abstract/Free Full Text]
  39. Shimokawa, N., Jingu, H., Okada, J., Miura, M. 2000, Molecular cloning of Rhombex-40 a transmembrane protein from the ventral medullary surface of the rat brain by differential display, Life Sci., 66, 2183–2191.[CrossRef][Web of Science][Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
F. Bolognani, T. Contente-Cuomo, and N. I. Perrone-Bizzozero
Novel recognition motifs and biological functions of the RNA-binding protein HuD revealed by genome-wide identification of its targets
Nucleic Acids Res., October 21, 2009; (2009) gkp863v1.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
G. Temple, P. Lamesch, S. Milstein, D. E. Hill, L. Wagner, T. Moore, and M. Vidal
From genome to proteome: developing expression clone resources for the human genome.
Hum. Mol. Genet., April 15, 2006; 15(suppl_1): R31 - R43.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (3)
Right arrow Request Permissions
Google Scholar
Right arrow Articles by Okazaki, N.
Right arrow Articles by Koga, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Okazaki, N.
Right arrow Articles by Koga, H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?